The International Association for Journal Writing Logo

How to Journal

Your complete guide to getting started with journaling.

Do you want to learn how to journal, but are unsure where to start?  Or you want to know what to write in a journal?  Maybe you’ve heard of creative journaling and are curious what it is? Perhaps you’re a writer and want to journal to deepen your craft?

This comprehensive “How to Journal” article will answer all of your questions about journal writing. For example, what journal writing is, how you can use it, and what benefits you can experience from this type of writing.  It also includes many journal writing prompts to help you get started. Lastly, while journal writing is typically a solitary act, you don’t have to journal alone or in isolation.  This article will tell you where you can get some help and support for your journal writing, including being part of a journal writing community or group.

how to learn to write journal

This Article Covers:

What is Journal Writing?

What can i use journaling for.

  • How to Journal – What are the Benefits?
  • Getting Started with Journaling
  • Creating a Journal Writing Ritual
  • How to Journal – What To Write?
  • How Often Should I Write in my Journal?

Do You Need to Write Regularly in a Journal?

  • How To Journal Consistently –  Creating the Journaling Habit
  • How to Journal – What Help and Support Can I Get?
  • In Conclusion

image of person learning how to journal

Before we talk about how to journal, let’s look at what journaling is.

Journal Writing is the practice of taking time for yourself to write and reflect on your thoughts, feelings and life experiences.  There are many suggestions for how to journal and what to write about. However, the beauty of journal writing is you can do it in your own way. This means you can really make it your own creative and life enhancing practice.

There are lots of people who write in a journal.  I recently heard that 16% of the world’s population regularly writes in a journal. You could loosely test this claim yourself by asking a group of friends or family if they write in a journal and see what percentage say yes.

Each person will give a slightly different answer when asked, “What is journaling?” But in essence, journaling is the simple and profound act of capturing and understanding our lives through expressive writing and story. Expressive writing includes writing about our thoughts and feelings while gaining self-awareness and new discoveries along the way. Journaling is all about exploring and enriching life through narrative, words and creative self-expression through writing.

Journaling is…

  • a powerful tool for personal growth, self-discovery, improved health and creative self-expression
  • a fun and creative life enhancing practice
  • used by many successful people, including Oprah and Jack Canfield (author of Chicken Soup for the Soul books), to achieve success in life and work

“Journal writing is one of the rare forms of writing in which freedom of form and content support each other magically.”   –  Stephanie Dowrick

You can use journal writing to get to know yourself better, solve problems, make life decisions, improve your health and increase feelings of gratitude and joy.  Journaling can also help you heal from stressful life circumstances, deal with grief and loss, or other life transitions. Or just journal for the pure love it!

Journaling is a fun, nourishing and creative practice that simply requires something to write with and write on. Whether it’s a pen and notebook, loose paper, cue cards, you get to choose your journaling tools!

People use journal writing in different ways for a variety of reasons. One person might journal to heal a broken heart writing an unsent letter sharing what they wish they’d said to that person.  Someone else might journal to celebrate their accomplishments and make a list of their recent successes in their journal.

There are also a wide variety of journaling methods and techniques to get the most out of your journaling. You can use it for whatever matters most to you at this time in your life.

How to Journal – What are the Benefits?

There are many evidence-based benefits of journal writing from over 30 years of research in the expressive writing field.  Yes, journal writing is a field of work!

People use the journaling process for many reasons, including to:

  • stimulate a healthier mind and body
  • vent and express thoughts and feelings in a healthy, constructive manner
  • increase self-awareness
  • create clarity for decision-making
  • track progress and personal growth
  • celebrate successes
  • heal emotional pain and trauma
  • increase self-care
  • manage stress and prevent burnout
  • gain broader and multiple perspectives
  • practice writing in a non-judgmental setting
  • improve creative thinking
  • preserve memories
  • get closer to God or a divine energy source

Today, journaling is widely accepted as a means for cultivating wellness as part of a whole person health approach. This includes the emotional, physical, psychological and spiritual dimensions of well-being. Journaling is also being used across various disciplines, such as education, psychology, leadership, business, health, creative writing, coaching and counselling fields, as a powerful tool for learning and growth.

How to Journal – Getting Started

Get organized.

One of the first things to do when you start a journal is get your journaling tools organized.

It can be fun to pick out your favourite pen and an inspiring journal. Look online or go into any book, stationary or office supply store and you’ll find all kinds of journals, pens, markers and other things you might like to use in your journal such as stickers or other creative touches.

So over time, you can experiment with your journaling tools. Do you like blank pages or lined? Would you prefer a small journal or a large sketchbook style journal?  Would you use the same style journal or mix it up and try something new each time you begin a new one?

Sometimes people use loose leaf paper and put their journaling pages in a binder, or write small entries on cue cards. And some people even use big 18 x 24 pages of paper for larger visual journaling entries. You can create a mixed media art journal and much more.

Image of hand starting to write in journal

Just Write!

The key is to pick some simple journaling tools to start with – a pen and notebook – and just start writing.

Your writing will teach you what you need. For example, I used to write in a small lined journal and over the years, my writing longed for larger, open, clear spaces to fill. Now I use an 8 ½ by 11 blank page sketchbook, spiral bound and I keep my pilot pen in the spine of the journal.

Find your own tools and make your own way as you write. The only way to journal, is to write. And then write some more.

Whether you’re an avid journal writer, someone who journaled in the past, or have never written in a journal before:

“There is a Spanish proverb which says: there is no road, we make the road as we walk. I would say the same thing about journal writing: we make the path as we write.” Christina Baldwin

How to Journal – Creating Writing Rituals

What is a journaling writing ritual.

Dr. James Pennebaker, author of Writing to Heal: A Guided Journal for Recovering from Trauma & Emotional Upheaval , suggests some conditions that help enhance the expressive writing process.  His research shows that creating a journal writing ritual is very beneficial.

Being focused, non-judgmental, and connected to your interior world fosters deeper writing. But, it’s not a frame of mind that everyone can simply switch on and off.

The idea behind creating a ritual is to create a unique environment and/or behavior which helps you sink into the best journal writing mindset possible. The purpose of the ritual is to take you away from everyday life. Your ritual contains the cues you create for yourself which help you become relaxed, alert, and reflective.

How do you Create a Journal Writing Ritual?

Here are some suggestions, but remember, the ritual you create to transition into deeper journal writing is uniquely yours.

  • Select some music that creates a sense of serenity. Play it for five minutes, focusing on simply listening to the music. Consider closing your eyes. Do not read your mail or straighten out your desk! You may want to have just one piece of music you use each time as your centering pre-writing ritual. Or choose three or four pieces you love for some variety.
  • Begin with several minutes of a meditation or a prayer. You can write just for the occasion or create something spontaneously each time.
  • Brew a cup of tea or coffee, or pour yourself some fresh juice. Perhaps a glass of wine? Spend a few minutes holding the cup, feeling the warmth, smelling the aromas of your drink and deeply enjoy those sensations.

Write in an environment that’s inspiring for your journal writing

  • This could be by a bright and sunny window or a softly lit corner nestled in a cozy chair.
  • Light a candle and while lighting the candle say an affirmation, your intention or make a wish.

Journal at approximately the same time each day

  • This doesn’t have to be at the same hour each day, but it’s helpful if it’s at the same time in your daily routine. For example half an hour before bed, which will work whether you go to bed at 10pm or at midnight.

The trick, of course, is to find the cues that help you settle in quickly. Initially, experiment with different rituals to see which feels best and then stick with the practice once you’ve found one you like. Remember to use as many of your senses (smell, sight, touch, hearing and taste) as you can when creating your centering ritual.

Image of woman journaling to create a ritual for how to journal article

How to Journal – What To Write

You can write about anything you want to write about. For example write about your day including your thoughts, feelings, problems, challenges, upsets, joys, successes and dreams. Here are some journaling prompts to help you get started:

  • Right now, I am feeling…
  • In the moment, I notice…
  • Currently, I am thinking about…
  • So far, the best part about my week is…

You can also write about what you don’t want to write about—and explore your resistance!

Resistance offers you information about where you’re feeling stuck, perhaps procrastinating, or simply not quite sure how to proceed. Here are some journaling prompts to play with around resistance:

  • At the moment, I don’t really want to write about (and then write about it anyways)…
  • I am feeling resistant because…
  • If I wasn’t feeling resistant, what might be different in my life right now…

You can free write (simply go to the page and start writing) or you can do more structured journal writing activities such as using prompts.

There are many other journal writing techniques and methods such as mind maps, cluster drawings, dialogue writing, captured moments, poetic writing and more that you can learn about and use to keep your journal writing fresh and interesting.

Access our free 7 Servings of Journal Juice for new ideas on what to write about in your journal. And you’ll also receive journal writing prompts, exercises, tips and our inspiring Journaling Museletter .

How To Journal – How Often Should I Write

There are no rules about how often you should write in your journal. Like anything, the more often you do something that’s good for you, the more benefits you get from it. I doubt you would go for one walk around the block and expect to experience significant health benefits from it.

The same is true for journaling. While that one walk would have offered you ‘in the moment’ benefits like time to relax, feeling good from moving your body, fresh air and more, the same is true for journaling.

You could gain a sense of relief, renewal and replenishment from just 10 minutes of writing about your thoughts, feelings and life observations.

Journal Regularly

Much like any other activity that’s good for you like brushing your teeth, meditating or eating a healthy diet, journaling can also be done regularly. Journaling makes a great healthy daily habit.

Set a Timer

I often facilitate timed journal writing exercises in workshops and retreats that I offer. It’s a core part of my Transformational Writing for Wellness Salon , a 6 week group coaching program that takes people into the heart and art of transformational journaling.

So often people say, “I can’t believe how much I wrote in just 5 minutes” or “I can’t believe I gained new insights when I just wrote for 7 minutes!”

Journaling to Cope

Many people only write in their journals when they are going through difficult times. Then once things are going better, they stop writing. This is also a valuable way to use your journal as a life companion to help you cope during stressful or troubled times.

The key is not to get too caught up in “shoulds”: I should journal today, I should journal more often. That’s because ‘shoulds’ can open the door for negative self-talk and feelings of inadequacy and shame. Instead, your journaling practice is best treated like a kind friend. You journal because you want to, and because it’s an enjoyable, or at least helpful, relaxing experience.

It’s a question that most journal writers face at some point. Does it matter if you write often in your journal? Well, whether you write regularly depends on your purpose for writing. Is it to preserve memories? To sort out issues? To track physical or emotional, spiritual, or intellectual progress? Track health symptoms?

If journal writing is pleasurable, then writing is its own reward. If journal writing becomes a task you “should” do, rather than something you enjoy, then you’ll write less consistently.

So part of the issue can be reframed by asking, ”How do I make journal writing pleasurable?” The answer to this question will help you find your own way to make journaling a consistent and enjoyable habit.

How To Journal Consistently –  Creating the Journaling Habit

Think of writing a journal entry as the lowest cost and highest benefit way of taking care of your health. Remember that writing about meaningful events or activities in your life has been proven to positively impact your overall health without major cost of time or money and without having to leave your home!

If you do want to write in your journal on a regular basis and truly create the journaling habit, here are a few ideas to help you keep writing consistently:

Make your journal writing more upbeat

  • Review the good things that have happened in your day—your attitude, your progress toward a goal, a minor victory, even a two-minute interaction with someone that went well.
  • Remind yourself about the good stuff in your life and your good qualities.

Write when you have difficult issues in your life that need to be resolved

  • Who doesn’t experience difficult times? Consider the time that you write in your journal as an oasis of self-nurturing in your day. It’s a time to vent, rant, reflect, and process just for you.

If possible, write at the same time every day

  • Incorporate your writing practice into a daily routine.

Make it short and fun!

  • Write a one-word journal entry that captures your day.
  • It’s a challenge to come up with that one word. You can think about it while you are doing some mindless life maintenance activity—like flossing your teeth, taking out the garbage, or folding clothes.
  • Then once you’ve determined that word, writing your journal entry takes almost no time.

Back to the question: Does it really matter that you write consistently?

Writing consistently helps you maintain your journaling practice. It means that when you re-read your journal, there are enough entries to have meaning and flow.

Your ability to write consistently in your journal will be determined by how you feel and doing what’s right for you. So, while you’re writing and when you finish, notice how you feel.

  • Did you like the process?
  • Were you feeling relaxed and soothed during or after writing?
  • Did you feel at times frustrated, angry, confused, despairing?

This whole spectrum of emotions is simply part of the process of journal writing. I know that I feel better most of the time after I write – like I’ve released a burden or relived a pleasurable part of my day.

How to Journal – What Help and Support Can I Get?

One of the best ways to learn more about how to journal is with the support of a like minded community. When we join with fellow journal writers there are regular opportunities to connect, learn and be inspired about journaling. People who like yoga connect in yoga communities, and the same is true for meditation, scrapbooking, running and more. There is a human instinct to find supportive communities who share our passion or interest, so we can learn and grow together.

At the IAJW, our journal writing community is for extroverts and introverts alike. Perhaps you want the inspiration and support of a community, but would rather sit back quietly and take it all in. Or maybe you want to chat with fellow journal writers live on our monthly Zoom Chats with guest experts. You can gain regular  help and support for your unique approach to journal writing.

People journal writing in group for how to journal article

Join our Online Journal Writing Community

We know there is power in community. So come join fellow journal writers in the International Association for Journal Writing ! We offer a learning and inspirational community for journal writers worldwide. Access monthly online writing circles, interviews with guest experts in the field of journaling and expressive writing, courses, journaling tools, e-books and much more.

We also have our Journal Writing Facebook group . Connect with fellow journal writers, receive journal writing tips and prompts to support you on your unique journal writing journey. Everyone is welcome!

Treat Yourself to a Journal Writing Retreat

Lastly, you might want to join one of our virtual Renew You Writing Retreats . Take 3 hours for yourself to journal in a guided and nourishing way. Whether you want to kick-start or reinvigorate your journaling practice, this retreat gives you time for creative self-care and renewal!

“Wow! What an awesome experience! I must admit I was a tad bit skeptical about an online retreat. But woah! Was I wrong! The Renew You Writing Retreat was so invigorating, uplifting, therapeutic, inspirational….just plain awesomesauce. Have you ever had an experience like that? You go in a little skeptical and come out blown away? Have you had the experience of being deeply inspired through writing and sharing with others? If not, you’re missing out! Thank you, Lynda, for creating such a wonderful space and experience.” Airial W. Dandridge, Certified Life Coach

How to Journal – In Conclusion

If you’ve read this far, I know you’re passionate (or at least curious about) the many benefits of  journal writing. Journaling is an empowering experience because you’re always the expert of your own life. Journaling helps you explore both your inner and outer worlds and make sense of your life experience.

As a Registered Social Worker and Certified Co-Active Life Coach, I have been immersed in human transformation, growth, change and wellness for the past 30 years. I’ve learned many different tools and techniques for self-care, healing and growth through my studies and first-hand experience. Journaling is my go to practice that helps me live an intentional, healthy and happy life. And it has helped many people to do the same! Including you, perhaps?

There is only one way to experience the many benefits of journal writing—pick up your pen and write!

“Writing was the healing place where I could collect bits and pieces, where I could put them together again…written words change us all and make us more than we could ever be without them.” bell hooks

May your journaling support you to live an incredible life!

Authors :  Lynda Monk, Director of IAJW and Ruth Folit, Founder of IAJW , partnered to write this How to Journal article, attempting to answer some of the most common questions that new and, in some cases, even seasoned journal writers have.

23 Comments

' src=

Such a wonderful article. Thank you for sharing!

' src=

Thanks, Diana!

' src=

I went to write lots bits to remember and copied it almost word for word in my common place book,but I love to write and am trying to get back into it,I’m writing for recovery from am 8yr relationship with a covert gaslighting narcissist,and I couldn’t write,let alone relax,I have been out for almost 2yrs,and when I start to feel joy or something didn’t work out and I’m hard on myself,I swear I can feel his presence in my house,he doesn’t know where I am,I left him and moved 2hr away in a different state,the feeling is almost overwhelming

Hi Dixie, personal writing can help heal from painful relationships. It’s great you are getting back into it!

' src=

Thank you both Lynda and Ruth for this wonderfully informative resource. Never too old to learn something new! Thank you both for bringing this to us.

Thanks, Lyn. Glad it offered some new ideas!

' src=

Great article Lynda! You’ve covered so many bases – lots of work, and very informative and knowledgeable as always :) Emma-Louise

Hi Emma, thanks for your kind feedback!

' src=

You two put together a beautiful and accessible piece here. It’s filled with all the vast experience and love you have for journaling. Thanks, Beth

Thanks so much, Beth! Your feedback means a lot to us.

' src=

Lynda, a beautiful gift to receive, words combing thoughts, insightful expressions and creative suggestions. Thank you for sharing a writing world held in heart, pen or typing starts journaling what is seen, felt or sensed from a human inner essence. Whole ❤️ Namaste.

Thank you, Denise! Namaste.

' src=

My name is Jacki Smallwood. I have been watching your sight on Facebook, and all the various gifts you have given while on the sight. I have been in a nursing home for 3 years and in quarantine for the past 11 months, not leaving my room, no guests, no funerals or graduation s. To keep my sanity u journal, I share my journaling with other residents through Messenger to help others cope. I don’t have access to copy machine nor anyone to take it out to staples. I am asking if anyone of your organization would donate material that would help me so much and then share with others. I get 45.00 a month from SS and need every penny for my needs. Anything you can do would be so helpful.

Seniors are a special group often ignored through this Covid.

Thank you for anything you could for me.

Jacky Smallwood

Hi Jacky, thank you for your note and request. I removed your mailing address from your original comment before publishing it for your privacy. I will reach out to you by email. I am glad journaling is helping you during this difficult time. More to follow, Lynda

' src=

Lynda, I’m very grateful to have ran across this article. I used to journal a lot when I was younger and I write poetry and music pretty consistently for the last few years. I have been told journaling could be amazing for me to get over some of my past pains and nasty relationships and getting to know myself, growing into a stronger (as well as better person), and just for my general mental health. So, as I begin to journal this very day, I was writing down many things that I want to include and accomplish with this journal inside the front pages of my book and I happened to run across your article! Now I just want to give you a big thank you BECAUSE I attained a lot of information, ideas, and format to include in my new journaling experience! I’m very excited to embark and I just wanted to let you know again I’m grateful for running across your words.

Chelsea Venice, Florida

Hi Chelsea, thanks for your note and for sharing some of your journaling hopes! I love the serendipity that you found our journaling website. We have lots of free journaling resources, including journaling prompts, that might be helpful along the way. You can find them here if you are interested: https://iajw.org/free-journaling-resources/ Happy journaling!

' src=

Thanks for your article esp the prompts to change the language and freshen up what I usually write.

' src=

wonderful article

' src=

Thank you so much for this article! When I was in my deepest months I would always journal but then once I got better I stopped journaling. I really want to get back into it but instead of writing about the bad in my life, I am going to focus on the good.

' src=

thank you for this article!

You’re welcome, Gwen. Thanks for reading.

' src=

I love the ideas for making journaling more appealing in order to journal more consistently. Sometimes I get so caught up in the “should do’s” that I forget that there really are no rules!

' src=

Very informative article on journaling! I’ve found journaling to be a wonderful practice for self-discovery and personal growth.

Leave A Comment Cancel reply

Please enable JavaScript to submit this form.

Save my name, email, and website in this browser for the next time I comment.

how to learn to write journal

The Write Practice

How to Write a Journal: 6 Tips to Get Started

by Pamela Hodges | 61 comments

Writers are collectors of ideas, and where do we keep them? On scraps of paper, napkins, the notes app of our phones, and sometimes in journals. But as anyone who's started a journal can attest, sometimes it's hard to begin and even harder to keep one going. So how to write a journal? What to write in a journal? Let's look at some simple ways to start capturing ideas. 

How to Write a Journal: 6 Tips

There are a number of ways to capture ideas, from keeping a gratitude journal, to a reading journal, to a project journal. No matter what type of journal you keep, let me share with you some tips from my journaling experience for how to keep a journal and why a journaling habit pays off for writers.

4 Advantages of Keeping a Journal

Julia Cameron, acclaimed author of The Artist's Way and more recently a 6-week program outlined in a book called Write for Life, begins the writing and artistic life with a practice she calls morning pages. In essence, she suggests writing three pages each morning to explore ideas and life, and to clear the mind.

The benefits of journaling this way are numerous. Writers who establish regular journaling time may find it helps them clear their minds and explore new ideas.

There are many reasons why it is a good idea to keep a journal. I want to share four big reasons this daily habit may help you with your writing process and develop your writing skills.

1. Remember details

When I traveled to Europe in 1978, I kept a journal of my daily life. I have notes from the trip to Greece where I wiped out on a moped, weeded sugar beets on Kibbutz Reshafim in Israel, and hitchhiked through occupied territory in the south of Israel.

There were several details of my trip that I had completely forgotten until I re-read my personal journals.

Recording the details of your life can enrich your stories. One year when for The Spring Writing Contest at The Write Practice, I wrote a story about when the IRS called me to say I owed money.

In my first draft, I wrote that the amount they said I owed was, $638. After I had completed the first draft I went back to the notes I had written in my journal, and the correct amount was over six thousand dollars: $6,846.48 to be exact. Well, maybe there are some things we don't want to remember.

Thankfully, I didn't send the money. It wasn't the real IRS. But it was even better than a writing prompt for a story idea.

2. Find old friends

Keeping a journal can help you find old friends. One of the women I met on November 26th, 1978, wrote down her address. I found her on Facebook and just sent her a message. (Social media and Google can also help, but the journal did remind me of her name.)

We'll see if she responds to my Facebook message. It has been almost forty years since she lent me a pair of gloves when I scraped my hand on the pavement when I fell off my moped.

3. Help process feelings and ideas

When you keep thoughts in your head it can be hard to know how you think and feel. Writing down how you feel will help you process your emotions , as feelings become words, which can be then be edited.

Processing your feelings and ideas can lead to personal growth and peace, but that's not all. Expressive writing can be therapeutic, but it can also help you flesh out characters later. 

4. Preserve the writer's history

When you are dead and a famous writer, your journals will give your readers insight into your life, thoughts, and process.

You may never sell more than one hundred copies of your book, you may never publish your writing, or your journals may only be read by the mice that crawl through your basement. Or your journals will be read by zombies after the zombie apocalypse, sharing insight into your life and daily routines.

If you don't want anyone to read your journal, keep it in a locked box and swallow the key. (Please don't really swallow the key. It would be unpleasant to have to find it again, and you might choke.) Put the key in a safe spot, and then remember where you put it. 

6 Tips for How to Keep a Journal (and What to Write in a Journal!)

Now you know why journaling can be helpful. But how should you journal? It is very personal, and you should do what works best for you. But I will give you some tips to help you get started on a journaling practice.

1. Choose your kind of journal

You have several options for how to keep your journal.

A book, where you write with a pen or pencil onto paper:  Write in a book that is not so pretty you are afraid to write in it. Keep the size small enough you don't mind carrying it in your messenger bag, and big enough you can read your handwriting. Do not try journaling at night when the only paper you have on your bedside table is a bandaid. The next morning I couldn't read my writing on the band-aid, and the idea I wanted to journal was lost.

The advantage of pen to paper is you can write without having to be plugged into an electronic device. You don’t have to worry about a dead battery, and you can write even when the sun is bright or the airline makes you turn off your electronic devices.

The disadvantage to a paper journal is if you lose the journal and you didn’t make a copy of it, you have lost all of the writing. But either way, the journal writing helps you pay attention and record the moments of everyday life that will fade with time otherwise.

Software: There are several software applications and journaling apps on the market you can use to keep a digital journal. Be sure they sync to the cloud, as you don’t want to lose your entries because you fry your computer's hard-drive. 

Journey and Day One can add photographs and text, and export all of your entries into a PDF. You can also journal in Google Docs,  Microsoft Word, or Scrivener and save your files to a cloud-based program that will keep your files safe if you lose your computer or pour water on your keyboard.

2. Date your entry

You think you will remember when it happened, but without a written date, you might forget. Make it a part of your journal writing routine to date the entry.

3. Tell the truth

The journal is a record of how you felt and what you did. Telling the truth will make you a reliable storyteller.

If you haven’t cleaned the seven litter boxes for a week, don’t write that you clean them every day simply because you want your readers one hundred years from now to think you had good habits. The beauty of journal writing is that you can record things honestly for yourself that you might not otherwise record or share. 

4. Write down details

Record details like the time, location, who you were with, and what you were wearing. Details will help bring the memory alive when you record using your five senses .

To this day, if I smell a certain kind of Japanese soup, I can remember vividly the day I flew to Korea to renew my Japanese visa, only to discover the Japanese embassy was closed for a traditional Japanese holiday.

5. Write down what you felt

What you were thinking? Were you mad? Sad? Happy? Write down why.

6. Write a lot or a little

A journal entry doesn’t have to be three pages long. It can be a few words that describe what happened, a few sentences about the highlight of your day, or it can be a short description of an event from your day, where you describe details to help you remember what happened. What time of day was it? What sound do you remember?

Your journal entry might be a drawing, a poem, or a list of words or cities you drove through. It is your journal, and you have the freedom to be creative.

You can use journal writing prompts or simply tap into a memory that floats into your mind. 

Bonus tip: How to write a journal entry

Aside from the date, you can write your journal entry in a number of ways. You can write stream-of-consciousness, try bullet points written rapid fire, you can use various art materials, or any form that speaks to you.  Try a list or a mix of writing and doodling, or even dialogue exchanges. 

The most important thing is just to take the journaling time and make a regular habit of it, even if it isn't on a daily basis. The words will show up when you do. 

When to Journal

There is no right or wrong time to write in a journal. Write when you will remember to do it. Do you always brush your teeth before you go to bed? Have writing in your journal be part of your bedtime routine. Perhaps put it on your bedside table, or beside your hammock, or on the floor beside your futon.

If you are a morning person, consider keeping your journal on the table where you drink your morning coffee, tea, water, milk, or orange juice.

These are only suggestions. You don’t have to write down your feelings or why you felt a certain way. I hate being told what to do. Even if it is a good idea. But I hope you'll give it a try and see if you find it unlocks your own writing. 

Do you write in a journal? Why is keeping a journal a valuable practice? Please tell us in the   comment s.  

Do you write in a journal? Do you think writing in a journal is a good idea for a writer, or a bad idea? Please tell us why in the comments .

Write for fifteen minutes about some aspect of your day as though you were writing in a journal. Your journal entry might be a drawing, a poem, a list of words, or a list of cities you drove through.

Please share your writing in the Pro Practice Workshop here and leave feedback on someone else’s practice today. We learn by writing and by reading.

' src=

Pamela Hodges

Pamela writes stories about art and creativity to help you become the artist you were meant to be. She would love to meet you at pamelahodges.com .

7 Killer Tips for How to Write a Bio

Join over 450,000 readers who are saying YES to practice. You’ll also get a free copy of our eBook 14 Prompts :

Popular Resources

Book Writing Tips & Guides Creativity & Inspiration Tips Writing Prompts Grammar & Vocab Resources Best Book Writing Software ProWritingAid Review Writing Teacher Resources Publisher Rocket Review Scrivener Review Gifts for Writers

Books By Our Writers

HIDDEN: Bodies, Loot, Caves, & Self-Respect

Get a Month of Journal Prompts

Enter your email for a free calendar with 31 daily journal prompts to jumpstart your writing habit today!

You've got it! Just us where to send your guide.

Enter your email to get our free 10-step guide to becoming a writer.

You've got it! Just us where to send your book.

Enter your first name and email to get our free book, 14 Prompts.

Learn more

How it works

Transform your enterprise with the scalable mindsets, skills, & behavior change that drive performance.

Explore how BetterUp connects to your core business systems.

We pair AI with the latest in human-centered coaching to drive powerful, lasting learning and behavior change.

Build leaders that accelerate team performance and engagement.

Unlock performance potential at scale with AI-powered curated growth journeys.

Build resilience, well-being and agility to drive performance across your entire enterprise.

Transform your business, starting with your sales leaders.

Unlock business impact from the top with executive coaching.

Foster a culture of inclusion and belonging.

Accelerate the performance and potential of your agencies and employees.

See how innovative organizations use BetterUp to build a thriving workforce.

Discover how BetterUp measurably impacts key business outcomes for organizations like yours.

A demo is the first step to transforming your business. Meet with us to develop a plan for attaining your goals.

Request a demo

  • For Individuals

Best practices, research, and tools to fuel individual and business growth.

View on-demand BetterUp events and learn about upcoming live discussions.

The latest insights and ideas for building a high-performing workplace.

  • BetterUp Briefing

The online magazine that helps you understand tomorrow's workforce trends, today.

Innovative research featured in peer-reviewed journals, press, and more.

Founded in 2022 to deepen the understanding of the intersection of well-being, purpose, and performance

We're on a mission to help everyone live with clarity, purpose, and passion.

Join us and create impactful change.

Read the buzz about BetterUp.

Meet the leadership that's passionate about empowering your workforce.

Find your Coach

For Business

How to start journaling for mental health: 7 tips and techniques

woman-writing-in-journal-how-to-start-journaling

Understand Yourself Better:

Big 5 Personality Test

Find my Coach

Did you know one of the most powerful self-improvement activities  is right at your fingertips?

No, it’s not working out or having good sleep hygiene  (although these are great habits). It’s something even simpler — learning how to start journaling.

Although it’s been around for thousands of years, journaling is currently having a moment in the limelight. From self-help blogs to famous authors like Deepak Chopra, everyone is talking about the life-changing benefits of learning how to journal.

Despite its recent soar in popularity, this isn’t just a new-age self-help trend. If practiced consistently, it can transform your mental fitness , emotional well-being , and even physical well-being .

Let’s explore the importance of keeping a journal and how to incorporate this powerful habit into your daily life.

subscribe-cta

What is journaling?

Journaling involves writing down your thoughts and feelings as you navigate everyday life. Journaling can help you understand and work through your emotions, especially when you’re feeling anxious or sad. It can also help you grow, become more self-aware, and gain meaningful insights.

The beauty of journaling is that there’s no right or wrong way to do it. It’s a deeply personal experience that can take many forms.

One day, journaling could look like a diary entry, similar to the ones you may have written when you were a teenager. The next day it can be a list of things that bring you joy or a list of goals you want to achieve .

Developing a journaling habit can help you work through your emotions, especially when you’re feeling anxious  or sad. It can also help you grow, become more self-aware , and gain meaningful insights.

For these reasons, journaling is one of the best self-improvement tools.

Having said that, it’ll come as no surprise that some of the most successful people in the world, including Richard Branson, Warren Buffet, and Arianna Huffington have kept journals throughout their lives.

5 types of journaling

Each person is different. You might want to use your journal to reflect on your behaviors, while your friend might want to keep track of their daily habits. Being clear about the intention of your journal will help inform the type you decide to start keeping.

Here are five common types of journaling to get you started:

1. Daily journaling

As the name suggests, this is a journal that you write in every day. The contents differs from other types of journaling, however, as you focus on sharing what you did and how you felt about it each day. 

This type of journaling can be helpful for individuals experiencing life changes or wanting to keep track of a period of their life. It can also be useful to kick off when starting a new job or career. Having a daily journal will be a great resource to look back on to see how far you’ve grown. It can also serve as a reference if you feel life is moving too quickly.

2. Visual journaling

When most people think about starting a journal, they think of writing. But visual journaling is mostly made up of images. Each entry uses drawings to tell your story. These can be simple line drawings, storyboards, comic strips, or stylized sketches. Experiment with different types of drawings to see which works best for you.

This type of journalism is good for individuals who do not enjoy writing or have difficulty expressing themselves with words. You might find language limiting and prefer a more visual representation of your journal entries.

3. Stream of consciousness/free writing journaling

Many writers use free writing as a warm-up before jumping into their novel or other long-form text. But it can be a useful tool for starting a journal, too. With stream-of-consciousness journaling, you write down thoughts as they flow through your mind. 

It can be difficult for your fingers to keep up with your brain, so don’t worry about your handwriting or spelling errors. The main goal here is to get the bulk of your conscious thoughts out so that you can unearth your deeper ideas and perspectives. You can start this kind of journal with an intention in mind or just jump in and see where it takes you.

4. Gratitude journaling

Studies show that gratitude is linked to happiness . Developing gratitude and a strong gratitude practice is shown to strengthen relationships and develop greater resilience in individuals. So starting to write a gratitude journal can be highly beneficial. Even adding a few bullets for things or people you are grateful for to your existing journal practice has benefits.

You can structure your gratitude journal in different ways. You can list the things you’re grateful for, weave them into a larger entry, or format them as short thank-you notes. You can then choose to keep these private or share them with others.

5. Bullet journaling

You may have seen a bullet journal and wondered how to use one. Instead of lines, they have evenly spaced dots to guide your entries. Bullet journals are highly customizable. They can be used to track everything from your mood to your daily steps. Or you can use one page as an agenda with bullets for reflections such as “one thing that made my day today” or “my intention for today.” You can also get creative with different colors and mediums to design your journal entries just the way you like.

young-woman-journals-in-nature-how-to-start-journaling

Benefits of journaling

While the act of writing things down seems simple enough, the results are powerful. Here are just some of the benefits of keeping a journal.  

1. Improves mental well-being

The COVID-19 pandemic has brought unprecedented stress and uncertainty  into our lives.

During this time, 4 in 10 adults in the US have experienced symptoms of anxiety and depression .

One way to deal with intense emotions and uncertainty during difficult times is to find a healthy outlet for them in the form of a journal. Journaling is proven to have a positive effect on mental health and reduce the effects of anxiety and depression .

2. Strengthens the immune system and recovery time

You’ve likely heard the expression, “An apple a day keeps the doctor away.” Well, it turns out journaling can have the same effect.

In a 2018 Cambridge study, participants were asked to write about their deepest thoughts and feelings surrounding the most stressful or upsetting events in their lives .

Four months later, those who wrote about their experiences for 15 minutes a day reported fewer visits to the doctor and fewer sick days.

Not only is journaling linked to long-term decreases in health problems, but it also helps you heal faster. Another study found that expressive writing helped speed up wound healing in older adults .

3. Gives you a place to express gratitude

One of the best ways to express gratitude  is by keeping a gratitude journal and writing down things you’re thankful for. Gratitude is proven to activate areas of the brain that are connected to positive emotions .

Feeling grateful also overpowers negative emotions, boosts optimism, and makes you more compassionate .

4. Helps you work through challenges

Journaling is proven to help people heal past wounds and challenging experiences.

A recent Duke University study  asked participants who experienced a recent traumatic event to undergo a six-week writing ‘intervention.’ This consisted of various writing prompts, including expressive, poetic, transactional, and mindful journaling.

The study found that writing increased participants’ resilience and decreased stress .

5. Helps you set and accomplish goals

One of the most effective ways to achieve your goals  is to write them down.

Putting your goals on paper helps you visualize them more clearly. Visualization is a powerful technique  used by elite athletes and CEOs. It involves imagining that what you want to achieve is already yours.

In 2020, Dr. Gail Matthews from the Dominican University of California found that people who write down their goals have a higher chance of accomplishing them  when compared to those that don’t.

The importance of journaling

The only way to reap all the rewards that come with journaling is to be consistent. This means making journal entries a daily habit  rather than an occasional hobby.

Writing daily is a powerful way to do inner work . It can lead to insights and breakthroughs and help you process difficult emotions  and situations.

Learning how to write a journal is also a great mindfulness practice  because it helps you focus on the present moment. Being present without worrying about the past or future is a very calming and peaceful feeling that relaxes the mind and body.

The calming effects of daily journaling can also help treat emotional exhaustion . For example, incorporating 20 minutes of journaling into your nighttime routine can help you unload heavy feelings of stress  before bed.

We could spend all day talking about the many benefits of keeping a journal. But how do you start one?

The process is simple, yet looking at that first blank page of your notebook can feel daunting.

What to write in a journal

This is a personal decision, and it can change over time. You might start your journal to gain clarity about what career you want and then adapt it to include a goal strategy. 

Here are some ideas to get you thinking about how you might want to use your own journal and what to write in it:

  • Personal or career goals
  • What you are grateful for
  • Quotes that inspire or motivate you
  • Reflections or revelations
  • Questions you hope to answer at a later date
  • Things you want to improve
  • Compliments to yourself
  • A long-term vision of where you want to be
  • Your activities and what you’ve done and experienced
  • Blockers or frustrations you’re struggling to overcome
  • What you eat in a day and how you feel afterward

writing-in-notebook-how-to-start-journaling

How to start journaling (and make it a habit)

Starting a journal can seem intimidating at first. Like any other habit, it takes a while before it becomes a repetitive part of your lifestyle.

Here are some journaling tips to help you start and keep a journal.

1. Find the journaling techniques that work for you

Many people prefer keeping a paper journal because it helps them develop and express ideas more clearly. But putting pen to paper isn’t the only way to journal.

When you first begin writing, it’s important to find the method that works best for you.

You may find that the ease of using a laptop makes journaling more enjoyable for you. You also don’t have to limit yourself to one method.

Say you prefer handwriting, but you get a burst of inspiration during your morning commute on the subway. In that case, you can use the notes app on your phone to jot down your thoughts before you forget them.

2. Let go of judgments (write for your eyes only)

There’s no right or wrong way to journal. When you’re writing, it’s important to practice self-compassion  and leave your inner critic at the door . Journaling is a judgment-free zone.

Don’t worry about things like grammar or spelling. You’re writing for your eyes only, not for an audience.

When you’re self-critical or afraid someone will read your journal, you tend to censor yourself and be less authentic and honest .

3. Keep expectations realistic

When you first begin journaling, don’t expect to write pages upon pages filled with insightful thoughts.

Having unrealistic expectations can actually discourage you from continuing your journaling practice because you don’t immediately see progress.

Like any other habit, you need to set realistic goals and take baby steps in order to see results.

4. Create a writing routine

It’s easy to write on days when you’re feeling inspired and motivated . But what about when you’re not?

Creating a writing routine and scheduling journaling time can help you stay on track, even on days when you’re feeling uninspired.

For example, you can set time aside every morning after breakfast or every evening before bed, even if it’s just for five to ten minutes. This time blocking  method allows you to prioritize journaling and incorporate it into your schedule.

5. Journal about anything that comes to mind

When it comes to what you want to write about, the possibilities are limitless. You can write about your day, your thoughts and emotions, or something that inspired you.

You can also use it as an outlet to release heavy emotions like anger, frustration, or sadness . Putting these feelings down on paper can free you from having them lingering in your mind.

In her book “The Artist’s Way,” author Julia Cameron talks about one method that can help you journal if you’re not sure where to start. It’s called the ‘Morning Pages.’

Each day after you wake up, open your journal and start writing three pages filled with any thoughts that come to your mind.

This stream-of-consciousness writing has been therapeutic for those who have tried it. It's helped them process emotions, gain clarity, and unlock their creative side.

6. Use journal prompts

There will be days when you’re staring at your journal and thinking, "what should I write in my journal?"

Don’t fret — there are countless journaling prompts online that can help you overcome your writer’s block. Here’s a list of things to journal about on the days you feel blocked:

  • A list of things and people you're grateful for
  • A recent situation that challenged you
  • An (unsent) letter to someone in your life
  • Small things that bring you joy throughout the day
  • The best decision you’ve ever made  
  • Daily positive affirmations

7. Get creative

Don’t be afraid to express yourself and be creative. Journal writing isn’t just prose. It can be poetry, sketching, art, lyrics, or anything else that allows you to express yourself.  

woman-drawing-how-to-start-journaling

How beginners can keep the habit

Learning how to start journaling is the easy part. It’s making it a daily habit that takes self-discipline.

But nobody said building good habits happens overnight.

If you stick to it, you’ll start to see the positive outcomes of journaling manifest in your personal and professional life. Use it as a tool for personal growth, self-discovery, relaxation, or visualization. There’s no right or wrong way to journal. Make it your own.

Ready to make a commitment to yourself? BetterUp offers personalized coaching to help you live a happier, more fulfilling life.

New call-to-action

Elizabeth Perry

Content Marketing Manager, ACC

105 daily journal prompts that’ll make you want to write

Write your way out of anxiety: 6 benefits of journaling, what is a bullet journal, and how can it boost your productivity, the best jobs for journalism graduates, no magic in manifestation how writing helps turn dreams into reality, how to start a manifestation journal: reach your goals through writing, journal your way to the future you want, 35 journal prompts for mental health and self-reflection tips, the secret to finding your passion isn't looking, it's doing, similar articles, 12 ways to start a gratitude practice, how to challenge yourself to start living your best life every day, 90 journal prompts for self-discovery to get the ink flowing, beyond happiness: learn how to be content with life, stay connected with betterup, get our newsletter, event invites, plus product insights and research..

3100 E 5th Street, Suite 350 Austin, TX 78702

  • Platform Overview
  • Integrations
  • Powered by AI
  • BetterUp Lead
  • BetterUp Manage™
  • BetterUp Care™
  • Sales Performance
  • Diversity & Inclusion
  • Case Studies
  • Why BetterUp?
  • Career Coaching
  • Communication Coaching
  • Life Coaching
  • News and Press
  • Leadership Team
  • Become a BetterUp Coach
  • BetterUp Labs
  • Center for Purpose & Performance
  • What is coaching?
  • Leadership Training
  • Business Coaching
  • Contact Support
  • Contact Sales
  • Privacy Policy
  • Acceptable Use Policy
  • Trust & Security
  • Cookie Preferences

Jennifer Lion

How To Start a Journal for Personal Growth: A Beginner’s Guide to Journaling

Hey love, Let’s talk about how you can start a journal. You probably remember the time when you were young and had a “Dear Diary”- style Journal in which you would write about your dreams, your crush and your biggest secrets. 16 years forward I found back to journaling and I never knew that it would be this AMAZING and POWERFUL. There is so much more to journaling than the typical “dear diary” style and I wish more people knew about it. That’s why I’m going to share with you how to start a journal + make it your favorite personal growth tool.

Step Number 1: Find Your WHY

In order to make the most out of journaling, it’s super important to find your personal WHY. When we have a strong reason for doing something, we are much more likely to actually stick to it. So step 1 of starting a journal is figuring out your “why”.

  • Why do you want to start a journal?
  • What do you want to achieve with it?
  • How is it going to help you on your journey?

Journaling can help you in so many areas of your life and I want to share some of the perks with you:

  • It propels you towards your goals, helping you bring your vision to life
  • It helps you become more emotionally balanced, giving you a chance to get all your emotions out on paper
  • It helps you identify subconscious thoughts that often go unnoticed in daily life. By reflecting yourself and your behavior, you identify thought patterns and limiting beliefs more easily
  • It helps you get creative and come up with inspiring ideas/ thoughts that you can then bring to life

how to learn to write journal

How To Journal?

The good news is that there are no specific rules to follow when you start a journal. However, I recommend trying out different techniques and then see what works best for you. It also depends on what you want to achieve with your journaling practice. Do you want to focus on gratitude, productivity, goal setting or mental health? There are so many different ways you can journal. Here are some journaling styles to try out:

1. Gratitude Journaling

Gratitude Journaling works like this: Every morning and evening, you write down things you are grateful for. I usually write down three things but feel free to write down as many as you can. It’s the ultimate happiness boost! If you are struggling to come up with things to be grateful for in the beginning, you can check out this list that I have created for you : 100 Amazing Things To Be Grateful For

2. Mental Health Journaling

Your mental health is SO important, so why not make it a priority with daily mental health journaling? Journaling can help you alleviate mental health issues like anxiety and stress, improve your cognitive and emotional power. This is how it works : You write down all your thoughts and feelings to understand them more clearly. Always remember: You are not your thoughts. So putting them out on paper (the good, the bad and the ugly), helps you gain distance from them and see things from a more productive, neutral perspective. See it as a therapy session with yourself where YOU are the one asking the questions.Here are some questions to ask yourself:

  • Is there a fear that’s holding me back right now?
  • Is there an anxiety that keeps on showing up for me?
  • Is there a part of my body that I tend to fixate on?
  • Is there a part of my relationship with my partner, friends, or family that needs healing?

Let your journal be a safe space for you to bring up, express, and process emotions.

3. Self-Empowerment Journaling

I LOVE using journaling for self-empowerment. Instead of waiting for other people to empower and believe in you, you can start empowering yourself right now. It works like this: Every day, you write down things you are proud of about yourself.

You can also choose positive affirmations about yourself (this is the ultimate confidence boost). So you could write down:

  • I am creative and use my skills to create my dream life
  • I am kind to all beings and spread love everywhere
  • I matter and I am making a positive difference in the world
  • I love myself and I’m my own best friend and support
  • I am committed to making my dreams a reality
  • I am a great ___________ (singer/dancer/content creator/coach/ human being/ friend/…you decide how you want to fill the gap)

Using these positive affirmations and allowing yourself to be kind to yourself, is so powerful. For more specific questions and journaling prompts that I personally use to empower myself, I highly recommend downloading this pdf that I have created for you:

4. “Stream of Consciouness” Journaling

This journaling style serves as a brain dump and is best done in the morning. This is the gist of it: You get all of the questions, thoughts, worries and feelings out of your head onto paper, so I can move on with the rest of your day.

When I do stream of consciousness journaling, I just sit down with a piece of paper. I use the same Moleskin Journal everyday. Then I set a timer and simply write everything down that is currently on my mind.

The key to this technique is not to second guess anything and just start writing and letting the words flow out of you. I recommend not paying attention to grammar or sentence structure (and yes, I’m saying this as a Linguistics graduate). Just let your writing be as natural, raw and imperfect as possible. There is one rule: Don’t correct yourself!

So let’s resume this technique in three main steps:

  • Take out your journal
  • Set a timer for 5 minutes
  • Write down everything that’s on your mind

After your brain dump, you usually feel much more at ease because the things you were stressing about are now on paper, not in your head anymore. As with everything, the more you practice, the easier it will get.

5. Journaling for Goal Setting

Writing down your goals will help you achieve them and it’s so important that you clarify what you actually want.

Define what you really want. No clarity, no change. No goals, no growth. – Brendon Burchard, Life’s Golden Ticket

For most people it seems obvious to break their goal down into a to-do list.

Sure, that can be helpful as well but if you’re not careful, a to-do list can spark the belief that the more you do, the more success you will have.

However, that’s not how success works and more often than not, long to-do lists make you feel even more stuck and overwhelmed. Ever had a really busy day but by the end of it asked yourself what you actually achieved? Then you know what I mean.

So this is how it works: You write your goals down every single day. Also make sure to describe your goals as vividly as possible. Vividly describing your goals in written form is strongly associated with goal success.

6. Question-led Journaling

This journaling style is great for beginners because it’s very easy to put into action when starting a journal. You simply write down the same questions every day and answer them for yourself. Here is an example of how you can do question-led journaling:

Questions for the Morning :

  • What are my three most important things that I want to get done today?
  • What am I excited about today?
  • What is my intention for the day?

Questions for the Evening:

  • List 3 things you are grateful for today
  • List 5 things that went well today
  • What could I have done better today?

Try it out and let me know what you think. I would love to hear your experience!

How To Stay Consistent with Journaling

If you have always wanted to keep a journal but struggled with making it a consistent habit, these tips are for you:

  • Implement journaling into routine and try to journal around the same time (for me, it’s in the morning and in the evening). Put it in your calendar and set yourself a timer for 3 weeks. After sticking to it for three weeks, it will become a habit.
  • Pick your journaling format: Decide on what kind of journaling style you want to do and stick to it for a while. After having established one technique, you can still add more.

Important Resources You Will Need

Here are some resources that you will need to successfully start a journal.

1) A pretty journal

how to learn to write journal

2. Pens to design your journal

I don’t know about you but I LOVE designing things and making them look beautiful. That’s an additional fun factor about journaling.

how to learn to write journal

Congratulations! Now you’re all ready and set to start a journal!

The Best Guided Journals

Another great way of journaling is using guided journaling. It’s less customizable but this way, you don’t have to write the prompts down yourself. It’s great for beginners and when you start a journal. My first journal was “The Five Minute Journal” and I still love it. I’ll link you my favorites below:

1) THE BEST JOURNAL EVER

how to learn to write journal

2) THE FIVE MINUTE JOURNAL

how to learn to write journal

Personally, I use a combination of both. I have one dotted journal that I use for different journaling styles and techniques and one guided journal with pre-written questions.

Final Thoughts

I hope this guide on how to start a journal inspired you and I am very excited for you to embark on this journey. Let me know how it goes. I always love hearing from you on social media or via email.

You are amazing!

Lots of love and until next time,

Sharing is caring

You Might Also Like...

how to learn to write journal

3 Things You Can Start Doing Right Now To Have More Energy for Your Dreams

how to learn to write journal

How To Feel Better – Quick Tips

morning routine positive mindset

6 Ways a Morning Routine Will Give You a Positive Mindset

' src=

Gratitude journaling helped me heal emotionally. I kept being grateful for all things I have and have become rather than how they might have impacted my life negatively. Journaling works wonder!

Leave a Reply Cancel Reply

By using this form you agree with the storage and handling of your data by this website. *

  • Legal Notice
  • Privacy Policy

Find A Therapist logo.

32 Easy Journaling Tips For Beginners

Written by:

Updated on:

  • January 7, 2024

Fact Checked

Looking for a therapist?

You’ve fished out your favorite pen and opened your brand new journal to its first spotless page. 

Journaling is a wonderful way to work through your emotions and dive deeper into your everyday thoughts and behaviors. If you want journaling to become  a habit that sticks , it’s important to find a method that will work for you in the long term. Some popular “journaling for beginners” approaches might not work for you, and that’s okay!

Even for the avid journal-keeper, starting a new journal can be intimidating. If you’ve never journaled before and have no idea where to start, use these journaling tips for beginners to get going.

Explore emotional well-being with BetterHelp – your partner in affordable online therapy. With 30,000+ licensed therapists and plans starting from only $60 per week, BetterHelp makes self-care accessible to all. Complete the questionnaire to match with the right therapist.

1. Tackling The First Page

You’re not making it up – first page jitters are real. If you feel paralyzed by the blank page in front of you, give yourself permission to not write on it!

Get your creative juices flowing to avoid writing on that first page. Instead, you can scribble, doodle, copy out a quote, write your name, paste in a photo, or rip it out entirely. 

If none of those ideas appeal to you, pick a random page in the middle of your journal and make your first entry there. Once your first journal entry is done, it’ll be easier to go back to the first physical page and fill it.

2. Keep a Prompt List 

One of the worst feelings as a journal-keeper is wanting to write, but feeling uninspired. Create a running list of journal prompts that you can turn to in a pinch.

Popular prompt lists include questions you want to try to answer, quotes that made you think, realizations you’ve had throughout the day, emotions you want to unpack, or memories you want to immortalize.  Some lists focus on different themes, such as  self-esteem and confidence  or the various relationships in your life. 

You can keep your prompt list on the inside cover of your journal, on your phone, or on a bookmark for your journal. Make sure it’s accessible to you at all times. That way, you can quickly jot down your prompt idea when inspiration hits. 

The  best journal prompts for beginners  will encourage you to write and flow as you dive into your thoughts and emotions.

3. Use a Guided Journal 

For first-time journal-keepers, a guided journal can be the perfect way to dip your toes into journaling. Guided journals provide a host of prompts and pre-filled pages to help you get into the journaling routine. 

Guided journals  can have different themes or focuses, so you can find one that perfectly matches your needs. Guided journals let you explore different types of prompts and see which ones work best for you.

how to learn to write journal

4. Find What Works for You

Journal-purists often say that putting pen to paper is the only way to go about journaling. In actuality, the best way to journal depends entirely on your preferences!

If physically writing out your thoughts is causing writer’s block, don’t force yourself to stick with it. You can type in Google docs or use your phone’s notepad application. Digital journals are easy to back up, access, and organize. And since typing is much faster than writing, you can end up with long entries without much effort!

5. Embrace Mess

Your journal isn’t here to look pretty. It’s here for you to explore your thoughts, work through big emotions, and encourage introspection. 

If worrying about your journal’s appearance gets in the way of writing, it can’t remain a priority. Let yourself be messy!

A fun way to demonstrate this concept is to make two journal entries. The first, you’ll make as beautiful as possible: use your best handwriting and fanciest pens, paste in stunning photographs, and spend hours decorating your entry with drawings and accents. 

For the next entry, do the opposite! Write as fast as you can and ignore how it looks. The point of this entry is to get out as many words as physically possible. Don’t worry about fancy headings or neat handwriting. Write until you fill the page. 

Which entry felt better? Which entry helped you the most? 

6. Don’t Edit as You Go

Similarly, your journal isn’t the place for perfectly constructed sentences and impeccable grammar, either. Go wild while you’re writing! If you make a mistake, scribble it out and keep going. ‘Mistakes” distract you from your train of thought. 

This might be one of the hardest habits to break, particularly if you do a lot of academic writing. When the urge to touch up, rearrange, and perfect hits you, ignore it until you’re finished! You can always polish your entry once you’ve finished writing, although this isn’t necessary.

how to learn to write journal

7. Carry Your Journal at All Times

When a thought hits you in the middle of the day, why not write about it in the moment? When your journal is with you at all times, you can write whenever inspiration strikes (and you have a few minutes to spare!)

If you can’t write the entry immediately, jot down a vague heading and some bullet points containing your thoughts and ideas. Later, you can remind yourself what you thought and write the full entry. 

8. Write to Yourself 

Writing to your past self is a great way to track your progress and growth. Try to remember what it was like to be 5, 10, or 20 years younger. What were you worried about? What were your dreams? After putting yourself in a smaller pair of your own shoes, write a letter to that version of yourself.

Write about the people you know now, your job, your family, your pets, your habits, things you’ve overcome, and areas where you’ve changed. Compare and contrast your life now and then.

Once you’ve written a letter to your past self, why not do the same for future-you? Write about your life currently and the ways you hope it changes or develops. Write about relationships you’re working on and projects you’re in the process of finishing. Ask your future self questions about how things ended up – after enough time, you’ll be able to read that letter and respond! 

how to learn to write journal

9. Write to Someone Else 

Are you struggling to talk to a friend or family member about something? Write to them in your journal to organize your thoughts. 

If you want to give advice, your journal is the perfect place to streamline it. When you start writing, your thoughts are convoluted and confusing. As you write, you find better ways to word what you’re thinking. This makes it easier to talk to people in real life because you’ve “practiced” your parts of the conversation. 

10. Write About What You Want 

Don’t force yourself to write about something that irritates you. Your journal is a tool meant for your benefit and growth. If you hate a prompt, get annoyed with a specific journal structure, or find an entire guided journal infuriating – you don’t have to stick with it. 

The journal serves you, not the other way around!

11. Write In Different Places

Different places will trigger different memories and bring out different aspects of your personality. Writing in different places takes advantage of that effect and brings out interesting thoughts and emotions. 

Write in bed, at your desk, sprawled on the floor, outside, at your favorite café, in the library, or even in your car parked outside the mall.

Practicing writing in a host of locations also trains you to easily transition into introspection and deep thought.

how to learn to write journal

12. Turn Off Distractions

Getting into a journaling session can be difficult. Make it easier on yourself by removing as many distractions as possible.

Turn off your phone if you can, otherwise put it on silent and place it face down. Put away anything that will distract you as you’re writing. 

13. Set a Timer

When you start journaling, it can be hard getting going. You’re still thinking about everything on your to-do list, your family, your boss’s cryptic comment in that board meeting… The list goes on.

To get yourself in a writing flow, set a judgment-free timer for 10 or 15 minutes. Write until the timer goes off. If it goes off and you’ve found a flow or are on a thought path you want to dive deeper into, you can continue! But you  can’t stop  until the timer goes off. 

Forcing yourself to sit and write helps to put you into a writing headspace and intentionally push aside your usual responsibilities. 

how to learn to write journal

14. Do It On Paper 

If you want journaling to become a habit, use it for big decisions, heavy thoughts, and large emotions. Worry, decide, process, and ponder on paper. 

By raising the stakes, you make journaling an important part of your process! 

For example, if you’re thinking of moving towns, you can make a pros and cons list, write about why you want that big of a change, and write about what’s making you hesitate. With all your thoughts collected in front of you, it can be easier to make your final decision.

15. Stream of Consciousness  

A popular journaling method is stream of consciousness or train of thought writing. For this style, write down whatever pops into your head. Try to write as quickly as your hand can move to follow your thoughts as they ramble and roam from topic to topic. Don’t worry about finishing sentences – if your thoughts switch, your writing must too!

This unstructured and organic journaling style might not work for you every time, but is great for getting you out of a thinking rut and encouraging thought exploration. 

16. 30 Day Journal Daily Challenge

A challenge is a sweet way to get yourself into a delightful new habit. Pick a month and make it your aim to journal every day. It doesn’t matter if you set aside time before bed, straight after waking up, during lunch, or at any other time throughout your day. 

Set yourself up for success by clearing obstacles out of your way. Wherever you decide to write, make sure you have your notebook and pen easily accessible. Aim for a time of day when you’re least likely to be interrupted. 

If you find sitting down to actually start gives you ants in your pants, remember Tip #13 and set a timer. Don’t leave until the buzzer goes! For a 30 day challenge, feel free to start small (a minute is fine!) and increase the time in small increments to develop your journaling muscles. Some days will flow, other days may feel like jogging through a patch of quicksand, but by the end of a month, you’ll be amazed at how much you’ve grown!

how to learn to write journal

17. Write About Another 30-Day Challenge 

If the thought of journaling for a month seems impossible because you’d have to figure out what to write each day, why not piggyback it on another challenge? There are plenty of 30-day challenges doing the rounds.

How about taking on a month-long exercise routine? Learn a new craft (macramé, anyone?) find out how to draw animals, or paint realistic ocean waves. At the end of the month, you’ll have gained a new skill and have established a lovely journaling groove.

Big life changes are a great topic for 30-day journaling. Starting at a new job? Going to therapy for the first time in your life? Have a new pet? Whatever you’re doing every day that is challenging you, write about your feelings! Journaling your way through a big change not only helps you adjust to the change, but it also gets you into a writing flow. You can look back at the end and see the character growth and change in your perspective.

18. Use Quotes As A Starting Point

If you love words and find inspiration in how other people phrase things, use their quotes as prompts! If a quote stands out to you for any reason, use it as a diving board to go deeper in your journal. You can expand on how you interpret the quote, how it applies to your life, or what you think and feel when you read the quote.

If you find the quote paralyzes you, take a different approach. Write the opposite of what the quote implies. Then you can write about which point of view resonates with you more and why.  

19. Write About Books

If your current life and thoughts feel a little too mundane to document, revisit your favorite books by writing about them. You can get as structured as you want to here – from scribbled plot musings to in-depth and aesthetic analyses. 

Analyze the characters, their motivations and flaws, write about how you relate to them and how you differ, write about the romances that felt most realistic and enticing.  

how to learn to write journal

20. Stay Honest 

Sometimes, it’s easier to gloss over ugly thoughts while journaling. To get the most out of journaling, it’s important to be as honest as you possibly can. If you’re hesitant to explore an opinion or emotion – dig in! Start by writing about why you don’t want to write about it. Once that reason comes surfaces, face it, acknowledge it, and push it aside. Writing about the tricky stuff is the only way to progress and grow!  

Remember that your journal is a private, judgment-free zone. If you’re anxious someone will snoop and see your private thoughts, find a secure place to put your journal or use a journal with a lock and key. 

21. Write Lists 

If sentences are eluding you, make arbitrary lists instead! To-do lists are the only exception here, unless the point of your journal is productivity and organization. To-do lists draw you away from your emotional side, making it more effort to introspect. 

You can make a  gratitude list , a list of favorites (movie, book, food, etc.), a list of names you like (perfect for expecting parents), days you want to experience again, places you want to travel to, and more. 

how to learn to write journal

22. Bullet Journal

If you want a journaling style that lends itself to organization and productivity more than it does to creativity and expression, give bullet journaling a try.

Bullet journaling is a popular way to keep track of daily, weekly, and monthly tasks. It’s simple, intuitive, and easily customizable to meet your needs.  This step-by-step tutorial  gives great steps for starting your own bullet journal.  

23. Dream Journal

If you want journaling to be part of your morning routine, why not write about your dreams? As soon as you wake up, scribble down as much of your dream that you remember. Once you’ve got the random details down, you can try to sort them into the order that they happened in.

This is a great way to train your brain to remember your dreams.

24. Pretend You’re In a Therapy Session

If you’re working through something, get objective and try to picture things from a stranger’s point of view. 

Imagine what questions a therapist would ask you, or remember questions that they already have and then answer those questions as you journal.

how to learn to write journal

25. Write About Now 

What does your room look like? What are you wearing? Get really specific. You can start with ‘the walls are white and there’s a desk’, but then take it further. What’s on the desk? What type of pens? Does the plant have patterned leaves? What do the patterns remind you of? To practice using this concept, write about each of your senses. 

  • Sight –  See everything around you and write it down
  • Hear –  Close your eyes in between paragraphs and listen to your world, then capture it in words
  • Smell –  You might want to go on a walk around your neighborhood, pausing to breathe and capture the scents
  • Feel –  Emotions? Fingertips? You decide!
  • Taste –  What flavors are actually in your favorite soda?

Investigate the world around you through the magnifying glass of the written word. 

26. Write About Religion 

If your religion is close to your heart and you want to dive deeper into your faith, write about it! You can write down prayers, discoveries, or testimonies.

You can also write about several religions to explore each of their approaches and philosophies. Which one resonates with you most? Why do you think that is? 

27. Affirmations

Write affirmations to work on your self-esteem. These can be about your appearance, your qualities, or things you’ve done that you felt proud of.

Write about yourself as you would a friend. Brag a little about everything you’ve achieved – you deserve to recognize progress, growth, and effort!

how to learn to write journal

28. Talk to Your Inner Child

Your inner child  is an unconscious part of your mind. It acts as the source of emotional, relational, and behavioral difficulties in your adulthood. 

Writing to your inner child can be an incredibly cathartic and healing experience. Talk to your subconscious in the second person (use you and your) and see what comes up!

29. Get Creative

Bring other methods of expression into your journaling – doodle, write poetry, draw, paste in stickers, paint a landscape, use charts and diagrams, stick in photos, or press flowers.

Multi-media pages can help you dive into self-expression and encourage creative exploration

30. A Different Point of View

Write from someone else’s perspective. Put yourself in their shoes and take a walk around their thoughts for a while. Write about their motivations, fears, and dreams. Try to figure out why they acted the way they did and why they have the knee-jerk responses that they do. 

This is a great way to  develop and practice empathy .

how to learn to write journal

31. Write About Your Values

What values do you hold dear? Where do they come from? How do they shape your decisions? Which values are most important to you? Which have you compromised on?

Writing about your values solidifies them for you, making it easier to act according to what you believe. Getting critical is a great way to weed out which values you believe in because you’ve been told you should. 

32. Unsent Letters

Journaling is a cathartic way to work through grief and regret. Whether you’ve lost a loved one, had a relationship sour, or been disappointed, write them a letter.

Your words are for your eyes only, but as the unspoken aches of your heart take substance on the paper in front of you, healing can begin. Allow emotion to flood through you and pour out through your fingertips.

If you feel numb and cold, write it down. So angry, you want to rip the page to shreds rather than write on it? Put it in words. There’s no right or wrong, but acknowledging what’s going on inside is a step towards freedom. You can do this! 

Journaling for Beginners Has Never Been So Easy  

Your reasons for journaling are completely unique. You may want to journal to relieve stress and anxiety, practice speaking kindly to yourself, practice speaking to others, work through big decisions or work through childhood trauma. Whatever your reasons, the result will be a confidence in yourself that no one can deny. 

With these 32 tips for journaling, you can confidently start your journaling journey. Whether you make journaling a daily habit or just use it for the big things, journaling is the greatest tool for self-reflection and creativity. 

What are you waiting for? Get a journal and get writing!

If you found this post helpful, be sure to check out the rest of  mental wellness articles  for more tips on journaling for beginners as well as other techniques for living a healthy, mellow, and stress-free life.

Additional Resources

Online therapy.

Discover a path to emotional well-being with BetterHelp – your partner in convenient and affordable online therapy. With a vast network of 30,000+ licensed therapists, they’re committed to helping you find the one to support your needs. Take advantage of their Free Online Assessment, and connect with a therapist who truly understands you. Begin your journey today.

Relationship Counceling

Whether you’re facing communication challenges, trust issues, or simply seeking to strengthen your connection, ReGain’ s experienced therapists are here to guide you and your partner toward a healthier, happier connection from the comfort of your own space. Get started.

Therapist Directory

Discover the perfect therapist who aligns with your goals and preferences, allowing you to take charge of your mental health. Whether you’re searching for a specialist based on your unique needs, experience level, insurance coverage, budget, or location, our user-friendly platform has you covered. Search here.

About the author

You might also be interested in

Amwell Therapy Review - Find a Therapist

A Comprehensive Amwell Therapy Review 2024

how to learn to write journal

How (And Why) to Get Rid of Toxic Friends

Cognitive Behavioral Therapy in Groups

Cognitive Behavioral Therapy in Groups: Effective Techniques

Disclaimers

how to learn to write journal

Online Therapy, Your Way

Follow us on social media

We may receive a commission if you click on and become a paying customer of a therapy service that we mention.

The information contained in Find A Therapist is general in nature and is not medical advice. Please seek immediate in-person help if you are in a crisis situation.

ssl secured

Therapy Categories

More information

If you are in a life threatening situation – don’t use this site. Call +1 (800) 273-8255 or check these resources to get immediate help.

Become a Writer Today

How To Write a Journal: Step-By-Step

Discover how to write a journal quickly and easily in our step-by-step guide.

I’ve kept journals in various forms on and off for twenty years. Journal writing is a skill that asks for commitment, practice, and honesty. It’s also a perfect practice for creative and successful people. And anyone can do it! This article walks through how to write a journal step-by-step and includes some advanced tips. It pairs nicely with our list of journal writing topics . But first, why even bother with journaling?

The Benefits of Journal Writing

1. journaling cultivates a daily writing habit, 2. journaling documents your life, 3. journaling tackles self-doubt, 4. it’s cheaper than therapy, 5. it cultivates personal growth, 6. journaling is a type of writing practice, step 1: pick a time for journaling, step 2: select a topic to write about, step 3: journal for a pre-determined period, step 4: don’t stop to edit , step 5: explore your thinking, step 6: stop and tidy up, step 7: review your journal entries regularly, keeping multiple journals, how to find time for journal writing, journal writing tools and resources, what do you write in a personal journal, how do you structure a journal, what is an example of a journal, what is the purpose of journal writing, journaling resources.

How to write a journal?

Journaling is a great pursuit for writers and creatives. I’ve journaled for years and recommend it to many writers. It’s easy to start a daily journaling practice, and it doesn’t take much time. But why should you keep a journal in the first place? To answer that question, let’s explore how some famous journal writers approached this craft.

Anytime, I avoid writing because I’m tired, bored, or devoid of ideas, I remind myself of the importance of discipline. Almost every writer I’ve read about sacrificed to pursue their work. They rose early or worked late into the night and they wrote because they had to and not just when they felt the hand of inspiration.

How to write a journal? Virginia Woolf

Like many famous journal writers, Virginia Woolf kept hers with a pencil and paper. She recorded entries every morning until the early afternoon. She wrote about her routine, her ordinary moments :

“I generally write with heat and ease till 12.30 and thus do my two pages. So it will be done, written over that is, in 3 weeks, I forecast from today”

Cheever bemoans his lack of discipline throughout his journals. However, in an entry written shortly before his death in 1982, he recognizes he possessed this essential and departing personal strength that comes with adhering to a writing routine.

“I have climbed from a bed on the second floor to reach this typewriter. This was an achievement. I do not understand what has happened to the discipline, or character, that has brought me here for so many years,” he writes.

Yes, discipline is important, but not at the cost of day-to-day life. For a long time, I thought there was nothing more important than filling a blank page with sentences.

Now, I spend time running, reading, traveling, meeting friends, and sitting quietly . I do other things that aren’t writing. And I’m OK with that.

Even if you’ve found a passion, side-interests are essential. When you’re in danger of burning out, taking time to pursue a side-interest will stoke the embers of what inspires you. Woolf chronicled her long walks while Cheever wrote dozens of entries about swimming, cycling, and meeting friends.

“I do have trouble with the dead hours of the afternoon without skating, skiing, bicycling, swimming, or sexual discharges or drink,” he writes.

The Russian writer Nabokov had little time for eating, socializing, or drinking coffee with friends.

Instead, he loved to solve chess problems and study butterflies. Both of these interests informed his work; his novel, Zashchita Luzhina (The Luzhin Defense), features an insane chess player. He writes in his memoir:

“And the highest enjoyment of timelessness…is when I stand among rare butterflies and their food plants. This is ecstasy, and behind the ecstasy is something else, which is hard to explain. It is like a momentary vacuum into which rushes all that I love.”

Self-doubt is a problem for many writers. They worry about what others will think of their ideas and stories. Years ago, I didn’t like writing articles like this one. I worried about how people will perceive me, and if I’ll upset or offend anyone. I learned from Virginia Woolf’s journals that many writers are insecure about their work. However, criticism can help writers improve their craft. She writes:

“What is the use of saying one is indifferent to reviews when positive praise, though mingled with blame, gives one such a start on, that instead of feeling dried up, one feels, on the contrary, flooded with ideas?”

Cheever wasn’t one for paying too much attention to his critics. He rarely re-read his works or reviews about them. That said, even Cheever occasionally dreamt (worried) about how people saw him. He writes in his journal:

“…and last night I had a dream that a brilliant reviewer pointed out that there was an excess of lamentation in my work.”

One way to overcome insecurity is to practice expressing gratitude. I try to do this by thanking those who take the time to read or even share my work, and by appreciating that writers today have more places to express themselves than before.

Vladimir Nabokov

Several years ago, I became a father for the first time. It was a happy time but after my son was born, I dreamt about death and how my life would end. I knew I wasn’t depressed but I worried there was something wrong with me. Then a friend (also a recent father), confessed the same thoughts. As we get older, it’s natural to consider mortality and death. To pretend death doesn’t exist is to live in ignorance of the bond we all share.

There are echoes of death in Woolf’s, Cheever’s, and Nabokov’s memoirs, and these authors taught me it’s unnatural to avoid considering our place in the world. In the opening pages of Speak Memory, Nabokov unpacks the notion of time as a single linear event. He challenged the reader to see not just the endpoint of life, but the beginning of life as well. He writes:

“….my mind has made colossal efforts to distinguish the faintest of personal glimmers in the impersonal darkness on both sides of my life.”

In short, journaling is good for your well-being and mental health.

John Cheever quote

Journaling is a good way of exploring your ideas, opinions, and inner beliefs. Through this habit, you can mark accomplishments and failures and also reflect on important life lessons. You could:

  • Set goals and track your progress towards these goals
  • Review your setbacks and move past them
  • Marking accomplishments and failures

The journals of Cheever, Woolf, and Nabokov taught me that keeping a journal helps identify negative patterns, thoughts, and behaviors. Woolf writes about her depression at length. In 1934, she describes the period after she finished her experimental novel The Waves .

“I was, I remember, nearer suicide, seriously, than since 1913.”

John chronicles his alcoholism at length in his journal and towards the end of his book, it’s hard not the feel the same sense of relief as he does upon finally becoming sober. If you want to learn how to write a journal, I don’t want to be too morbid and put you off. The journals of these authors aren’t all filled with dark life lessons and lamentations. Sometimes, these writers express gratitude.

Nabokov writes at length about his love for his mother and father, his son, and Russia of old. And I’ve yet to read a more powerful personal mission statement than Cheever’s aspiration for the blank page:

“To write well, to write passionately, to be less inhibited, to be warmer, to be more self-critical, to recognise the power of as well as the force of lust, to write, to love.”

Writer’s block describes feeling uninspired and having no great ideas to write about. Thankfully, you don’t need to worry about that while journaling. After all, your journal ideas and entries are for you and you alone. Simply, turn up for a few minutes at the same time each day and jot down what you’re thinking or doing. It’s also helpful for:

  • Articulate your arguments and ideas privately
  • Reflect on recent lessons from your personal or professional life
  • Chart your progress towards your goals
  • Reflecting on your to-do list or creative projects

Even if you don’t turn journal entries in public works, reading back on older entries from your own life is entertaining and revealing.

How to Start Writing a Journal: 7 Easy Steps

You don’t have to be a writer to learn how to journal. To practice journaling, write a short entry at the same time of day, every day. If that sounds like too much work, try once a week.

If you want to learn how to start a journal on your computer, use a dedicated journaling app like Day One. It’s built for digital journaling and supports images and videos as well.

Alternatively, create a password-protected file using Word, Pages, or another writing app on your computer. Ideally, it should sync with a service like Google Drive so you don’t have to worry about losing entries. With that in mind, follow these steps:

Open your journaling tool of choice, close the door, and relax. If you have one to hand, pick a single journal writing prompt. Eliminate any distractions including your phone and social media. It’s easier to follow a journaling habit if you stick to it at the same time every day.

A journal entry works well if it’s about a single topic, e.g. your daily routine, creative projects, or a personal problem. That said, there are no rules. Free write if you have to. Often the biggest challenge with creating a journaling habit is figuring out what to write about. You can start a journal entry in several different ways. Here are some creative things to write about in a journal:

  • What you did yesterday
  • You plans for today
  • An inspiring book, film or album
  • Lessons from a course you took
  • How you’re feeling
  • An argument you had
  • A memory from you past
  • Progress towards a goal
  • A problem at work or in your persona life

Julia Cameron, the author of The Artist’s Way, advocates keeping morning pages. These are a great way of starting a journal entry . All you have to do is get up, sit down at your desk and write a stream of consciousness entry first thing.

Set a timer for twenty-five minutes. If that’s too long, aim for five minutes. Consistency is more important than duration. Depending on what’s happening, you may have time to write longer journal entries at the weekend or evening time. Oh, and keep writing!

While writing a journal entry, don’t stop to edit yourself or edit for punctuation until the buzzer sounds. Editing and journaling are different activities. Also, journal entries are for you alone, so it doesn’t matter if you write a stream-of-consciousness .

Allow for negative thoughts, expressive writing, and random ideas to make their way into your journal entries. Reflective journaling is a type of therapy and a window into the soul. So, don’t hold back.

When the timer sounds, re-read your journal entry and tidy it up. Then, move on with your day.

Review your journal entries and writing process once a week, month, or quarter. Past entries should inform future entries. I don’t recommend revising old entries much though, beyond fixing typos and grammar errors. It’s easy and unhelpful to judge an old version of yourself. When in doubt, write a new entry.

I’ve kept various journals on and off since I was fifteen years old. These days, I record a personal journal containing the types of entries you would expect to find in someone’s journal or diary, i.e. it’s about my day-to-day life.

I write 200-300 word entries every morning and a longer entry at the weekend. It’s kind of like my morning pages (an idea advocated by Julia Cameron). I also record a professional or business journal . Here, I write about how this blog and my work is progressing. I also describe the challenges I’m having and what I’m working on.

Finally, I keep a type of Zettelkasten in Day One, which acts as a repository of ideas and information I come across for future writing projects. Here, I record snippets and other information from books I read, courses I take and talks I watch. I also include the links and write a reaction to these. This journaling habit gives me more source materials for future articles. For example:

This Zettelkasten or Slip box contains dozens of entries about writing advice from creative masters like John Cheever and Virginia Woolf. I used a few of them for this article! If you want to learn more about the Zettelkasten method, check out my podcast interview with Sacha Fast .

I won’t lie; if you want to keep writing a journal, you must commit to the practice. Some people who want to keep a journal say they find the process time-consuming, that they forget to write regular entries, and that it can become a chore.

These are valid concerns for journal writers. I spend several hours each week on journal writing. However, if you’re new, start with five minutes a day, ideally in the morning before you forget. Wake up early if you have it.

If you’re experiencing these problems, accept that there will be times when you don’t or can’t write. Instead, remember the benefits of journal writing and that no one needs to read or see this work (i.e. it doesn’t have to be perfect or even polished). You don’t need to keep more than one either. I’ve shared how I practice journal writing in case it helps.

Using Journal Writing Prompts

Some mornings it’s hard to write while tired and under-caffeinated. So I created a personal list of journal writing prompts and used those for a long time. Day One app contains daily journal writing useful prompts. I also like taking pictures of my phone while out and about and using these to start writing entries faster. Sometimes, I just write up what I did yesterday.

I occasionally use TextExpander for OS X ( Phase Express is a Windows alternative) to write entries faster. These are text-expansion apps that turn keyboard shortcuts into snippets of text that I use for my entries.

For example, when I type “; journal”, TextExpander pastes the following questions into my personal journal:

How am I feeling right now? What are my plans for today? What did I read/listen to? How did I help my family?

When I type “; blog”, Textexpander pastes the following questions:

What did I do yesterday? What lesson did I learn? What could I have done better? What one thing must I focus on this week?

I use a semi-colon to prevent Textexpander from inadvertently creating this text while I’m working on something else. These questions serve as writing prompts . When I see them appear on the page, I spend less time thinking about “what I want to write” and more time answering these questions. You can also find several dozen journal writing prompts in my book Yes You Can Write!

  • A notepad: you can’t beat the classics!
  • Day One : a dedicated app for Mac and iOS users
  • Journey: a diary app for Android
  • The Daly Stoic Journal by Ryan Holiday: Packed full of journaling prompts, I keep a copy on my desk
  • The Early Morning Pages by Julia Cameron: a guide to writing in the early hours
  • A password-protected file: nosey-parkers, keep out!
  • Onenote or Evernote: both are useful if you like tagging entries
  • WordPress: you can password-protect your entries
  • Yes You Can Write!
  • Speak Memory

If you want more, check out Anthony Metevier’s post How To Keep A Journal And Remember More and also my detailed guide on Medium.

FAQs on How to Write A Journal

You can write whatever you want as each entry is for you alone. Some good topics include what you did yesterday, goals, your to-do list, and personal or professional challenges.

Journal entries typically don’t require much structure. However, it’s a good idea to date your entries so you can understand your journal’s chronology.

The novelist John Cheever’s journals and Virginia Woolf’s journals are both good examples worth reading.

Journal writing enables you to clarify your thinking, work through negative emotions and record your daily life. It’s also a form of writing practice.

The Best Journals to Buy

Diary Vs Journal: What’s The Difference?

Adam Jelic interview , the creator behind MiGoals journals

how to learn to write journal

Bryan Collins is the owner of Become a Writer Today. He's an author from Ireland who helps writers build authority and earn a living from their creative work. He's also a former Forbes columnist and his work has appeared in publications like Lifehacker and Fast Company.

View all posts

How to Write a Journal Guide

  • How To Start and Write a Journal

We keep a lot of things in our heads, but we put less down on paper. All those thoughts and ideas bouncing around can sometimes feel overwhelming. You have to-do lists, hopes, dreams, secrets, failures, love, loss, ups and downs. Ideas come and go, feelings pass. How do you remember all of them? How do you keep them organized? A great way to keep your thoughts organized and clear your mind is to write them down in a journal. Writing is a great exercise for anyone and by expressing yourself in a personal place is a wonderful way to stay sane. 

Starting a Journal

To start a journal, you just need to be willing to write. You don’t have to write well, you just need to want to do it. You don’t even need to decide what to write, you just need to let your words flow. Once you’ve decided you want to create a journal, here is a long list of instructions to guide you: 

Set up a schedule of when you play to write in your journal. You want to turn your writing into a habit, so create a schedule. Pick a time and the days of the week you will want to write and create a timely calendar reminder, so you don't forget. By scheduling the same times, journaling will become a natural and regular part of your agenda that you can look forward to. 

Screenshot of a modern calendaring application used to help schedule when you should journal.

Find the right space to write.  

When you’re writing, it is helpful to be in a space where you can focus and concentrate. A quiet room with no distractions works best. Allow yourself to focus on your writing, without any interruptions. Make sure you are able to sit upright and are comfortable. An office or a study room is always great.

A cozy and private desk space perfect for conentrating and focusing on journal writing.

Buy a physical journal or Sign-up for Penzu

Penzu is a digital journal that will allow you to write from any device. It will make your journal writing incredibly easy-to-use, accessible, organized and private. It will save all your work and date it for you, so you never need to remember. It is a great tool for writing anywhere and keeping your work in one place. 

Screenshot of the modern and sleek Penzu signup flow. Just enter your name, email, and password to get started.

Close your eyes and reflect on your day. 

You may not know what to write about and that’s okay. Your journal can be about anything you want. A good way to begin writing is to close your eyes and think about what you’re feeling. 

A woman meditates before recording her reflections into her journal.

Ask yourself questions.

What has happened that day? How did that make you feel? Are you excited about anything? Why? Reflect on the thoughts and feelings you’ve been having.

Woman standing in front of a cloud of question marks on a chalkboard.

Dive in and start writing.

It is easy to begin sentences with, “I feel,” or “I think,” or “I wonder.” Don’t feel pressured to stick to any particular form or topic. The beginning of your journal writing can just be an introduction to your thoughts at the time. This is your personal space, so you should feel comfortable writing. 

A pen rests on a blank pad of writing paper - perfect for sharing your reflections, thoughts, and feelings.

Time yourself.

Set a time for how long you want to write. Somewhere between 5-20 minutes is ideal, depending on how much you want to jot down. Setting a time will help you stay focused and stop you from getting carried away. It is easy to feel like you need to write down every detail and this will help prevent that. 

A hand holds a stopwatch ready to start the timer whenever it's time to start journaling.

Re-read your entry and add additional thoughts. 

A hand holds a pen over a full page of lined writing paper in a notebook.

10 Tips When Writing a Journal

Here are some tips to get started properly and consistently writing in your journal.

1. Set a schedule

As we mentioned earlier in the article, setting a schedule is a great first step. Decide how many times you want to write and set a schedule. Whether it be once a day, or once a week, decide on a time you want to write and don’t skip it. 

2. Keep it private

A journal is personal and should be a place you feel comfortable expressing yourself honestly and truthfully. Penzu keeps your journal safe and secure, with all your entries made private by default, only made available to share under your command. 

3. Meditate

Any journal entry will benefit from some moments of reflection before you begin writing. Before you start writing, go to a quiet place and focus on your breath for a few minutes. This is a wonderful exercise to clear your head and settle your thoughts . 

4.Brainstorm

If you want your journal to be about something specific, brainstorm ideas to write about. You can write a bible journal , a dream journal , cooking, work, school, anything you want! Feel free to start writing down ideas of what you are interested in or feel you should be writing about. This is the perfect place to get your creative juices flowing. Check out this page for a list of all the different types of journals .

5.Date your entry

It is important to keep each journal entry dated, so you know when you wrote it. You will want to go back through your journal at some point and see when the entries of the topic you’re writing about were added. Also, it will be nice to see how you were feeling at different points in your life. Penzu automatically dates your entries for you, so you don’t have to worry about remembering to do it. 

6.Title your entry

If you can, try and title your entries. This will help you navigate your journal and keep your writings focused. You don’t need to title it before you start writing though. A great way to think of a title is after you’ve written, but it is something to keep in mind. 

7.Write naturally

When writing, don’t feel like you have to follow any form or structure. Just do what comes naturally. Follow your train of thought and see what kind of writing follows. 

8.Write quickly

Don’t let writer’s block get in your way. Just keep writing whatever comes to mind. It is always hard to stop and start again, so keeping writing. It doesn’t have to make sense. Don’t think too much about the words you are putting on the page. You can make sense of them later. 

9.Write honestly

Your journal is for your eyes only, so be honest. You don’t want to lie to yourself. Be real with your thoughts, feelings and opinions. Be as candid as you can. You want your journal to be an honest representation of yourself and the times you’re writing in. 

10. Have fun

Writing a journal should be an enjoyable experience. Have fun with your writing and take pleasure in it. Writing in your journal shouldn’t be a chore. It should be something you look forward to doing, so make it a fun exercise. 

8 Extra Tips For New Journal Writers

Writing a journal entry is different for everyone. We all write differently and about different things, so it is a different experience for everyone. We can help with pointing you in the right direction, whatever that direction may be. Here are some tips to get you started:

1. Think about what you want to write. 

Your journal doesn’t need to have a theme, but an easy way to start writing an entry is to think about what you want to write about. 

  • Do you want to write about that day’s events? 
  • Do you want to write about your plans for tomorrow?
  • Are you planning a trip?
  • Are you working on a project?
  • Are you in a new relationship?
  • Do you want to discuss your family?

Decide what you wish to discuss and go in that direction.

2. Try writing with a journaling prompt

If you are having trouble deciding on a topic, try writing personally and/or creatively to get you started. Here are some journaling prompts you could think about:

  • What is your earliest childhood memory?
  • What is/was your favorite subject in school? Why?
  • Write a poem about your first romantic encounter.
  • What is your biggest secret?
  • Who is someone in your life that made a large impact on you? Why?

3. Plan ahead

Make sure you have a designated time to write. That way you can start thinking about what you want to write throughout the day and can prepare ideas. This will also get you looking forward to writing.

4. Practice

Write as much as possible. Writing will become easier you more you do it. Try and get into the habit of writing regularly and your entries will start coming to you naturally. 

5. Write letters

There are certainly times in your life where you wish you said something, or wish you didn't say something. Write about these moments. Think about writing letters that you will never send. They can be addressed to specific people or not, but they are great outlets for honest thoughts and make for compelling entries.

6. Try different perspectives

A helpful method of writing is to write from different perspectives. Pick a topic or event to write about and try writing in from someone else’s perspective, like a parent’s, a friend’s, or even an animal’s. It is healthy to think about things from different points of view. 

7. Add pictures

Pictures say a thousand words and can certainly inspire more. With Penzu you can import photos right into your entries, so feel free to add them throughout or just at the beginning to give you inspiration. You can talk about what is happening in the picture, the person that took it, what isn’t pictured, or just what it means to you. Think of it as giving the picture a long caption. 

8. Free write

Free writing is without direction, structure or motive. This means just take yourself to the page and go wild. Whenever an idea pops into your head, just write it down. It doesn't have to be cohesive or have a purpose. 

To Start Writing in a Journal With Penzu

Now that you’ve learned many tips of how to start and write in a journal, it’s time to get started with Penzu. Here’s how to get started:

  • Grab your phone, computer or tablet.
  • Make sure you are connected to WiFi.
  • Go to Penzu.com to create an account.
  • Enter your name, email and a password for your account.
  • Download the apps.
  • Log in and begin writing!

Writing journals is simple and easy! Download Penzu today and get let the words flow!

There's no time like the present - start your free online journal today!

Penzu Mobile Phone apps

Loved by millions!

Get access to your diary wherever you are – download the free Penzu app for your all of your iOS and Android devices today!

Penzu Apple App Store link

Journal Basics

What is a Journal?

Journal Entries

Benefits of Journaling

Journal Types

  • Journal Examples
  • Journal Prompts

Ideas for Journals

Travel Journal

Create a collection of adventures, stories, memories, and discovery while you travel. You’ll remember more about your trips and appreciate everything you experienced.

Prayer Journal

Deepen your relationship with God by writing down your prayers every day. Learn by reflecting on prayers that have been answered, and others that haven’t.

  • Dream Journal

Dream journals are instrumental in fields as diverse as psychology, natural science, creative arts and advanced mathematics. What is your subconscious trying to tell you?

  • Bible Journal

Bible journals can provide you with a therapeutic way to better cope with everyday situations, understand your feelings and establish a connection between your life and the biblical content.

  • Pregnancy Journal

A pregnancy journal helps you remember important information about your health and make better decisions while you're expecting.

  • Free Signup
  • What is a Journal
  • Reflective Journal
  • Five Year Journal
  • Secret Diary
  • Electronic Diary
  • Diary Templates
  • Wedding Diary
  • School Diary
  • Health Diary

Copyright Penzu Inc. 2024

The Center for Journal Therapy

Writing in a Journal: A Short Course on Journal Writing for 2023

Do any of the following statements or questions sound like you?

  • “I don’t have time to write a journal!”
  • “I don’t know what to write about!”
  • “How do I get started?
  • “I’m a lousy writer!”

If so, then this short course on journal writing is for you! Here are five easy steps to get started with writing, eight suggestions for new journal writers, and 14 writing techniques for your journal.

How to Get Started with Journal Writing

It’s Easy to W.R.I.T.E.

Just try these five easy steps. You’ll be writing in no time!

W – What do you want to write about? What’s going on? How do you feel? What are you thinking about? What do you want? Name it.

R – Review or reflect on it. Close your eyes. Take three deep breaths. Focus. You can start with “I feel…” or “I want…” or “I think…” or “Today….” or “Right now…” or “In this moment…”

I –  Investigate your thoughts and feelings. Start writing and keep writing. Follow the pen/keyboard. If you get stuck or run out of juice, close your eyes and re-center yourself. Re-read what you’ve already written and continue writing.

T – Time yourself. Write for 5-15 minutes. Write the start time and the projected end time at the top of the page. If you have an alarm/timer on your PDA or cell phone, set it.

E – Exit smart by re-reading what you’ve written and reflecting on it in a sentence or two: “As I read this, I notice—” or “I’m aware of—” or “I feel—”. Note any action steps to take.

In summary….it’s easy to W.R.I.T.E. ! W hat topic? R eview/reflect I nvestigate T ime yourself E xit smart

Looking for free journaling workshops?  Check out our on-demand courses including “ J is for Journal: A Short Course on Writing for Healing, Growth, and Change ,” with seven lessons containing a total of 68 writing prompts!

Eight Suggestions for New Journal Writers

1. protect your privacy..

Store your journal in its own special place so that the temptation for others to read is diminished. Ask for agreement with your housemates that your journal is private. Reserve the first page of any new journal for your name and phone number or e-mail address, along with a notice: This is my personal journal. Please do not read it without my permission. If none of that would stop whoever might read your journal, get a shredder. Find a creative way to protect your privacy, such as a new gmail or yahoo account, freshly passworded, from which to write yourself at that address. Or keep your journal on a flash drive. Make your privacy an intentional act.

2. Start with an entrance meditation.

Nearly every journal technique benefits from a few minutes of focused quieting. Use visualization, soft music, candles, deep breathing, stretches, whatever works for you.

3. Date every entry.

If you only establish one habit in your journal, let it be this one! Dating every entry allows you to chronologically reconstruct your journal by date. It also lets you hear the silence between your entries.

4. Keep (and re-read) what you write.

Often the writes that feel like throw-aways contain the seeds for future insight. Keep it, re-read it later, and surprise yourself with how much you knew that you didn’t know you knew!

5. Write quickly.

You can outsmart dreaded “journal block” by writing so fast that the Internal Critic and the Internal Censor can’t keep up. Keep your pen moving!

6. Start writing; keep writing.

Start with the present moment (“What’s going on?”) Or start with a feeling (“I’m so mad I could bust!”) Or start with a story (“Today the weirdest thing happened….”) Once you’ve started, don’t go back to edit or rewrite. And don’t think too much. Let it flow.

7. Tell yourself the truth.

Your own truth is not your enemy. Don’t try to talk yourself out of knowing what you know or feeling what you feel. Give yourself permission to tell the truth. Also give yourself permission to pace yourself. If the truth seems too bright or harsh, then slow it down.

8. Write naturally.

If there is one inviolate rule of journal writing, it is that there simply are no rules! Do what works. Don’t worry about what you’re not doing. Give yourself permission. Let yourself enjoy the process!

14 Writing Techniques for Your Journal

1. sentence stem..

A sentence-completion process. Fill in the blank with a word or phrase. May be very universal (Right now I feel———-) or highly customized to an individual’s immediate question, problem or interest.

Start with the beginning of a sentence:

  • Today I will—
  • Right now I feel—
  • The most important thing to do—
  • I want—
  • I need—-
  • What I wish I could say to you—
  • If only I could—
  • I wonder–

—and finish it with a word, a thought, the rest of the sentence.

Boom. You’re done.

2. Five-Minute Sprint .

A timed writing process designed to bring focus and intensity in short bursts. Excellent for those who are resistant or aversive to journal writing, or who are uncertain about how to start, or who state they do not have time to write journals.

It’s a two-step process that couldn’t be more simple:

  • Set the timer on your phone or kitchen stove. Stop writing when signaled!
  • Keep your pen or fingers moving the entire time. It’s only five minutes. It goes fast.

Ready? Set your timers–and WRITE! Start with this prompt: What’s going on?

3. Inventory.

An assessment of life balance in major areas of living (health, family, home, work, spiritual/religious, emotional well-being, etc.) Gives a quick picture of which life areas might need attention.

4. Structured Write.

A series of Sentence Stems grouped and sequenced to reveal consistently deepening layers of information and awareness.

structured write journal writing technique example

5. Clustering.

Visual free-association from a central word or phrase. Lines and circles connect key thoughts and associations to the central core. Work quickly to maximize results. A brief writing to synthesize findings may follow.

clustering example for journal writing technique

6. Lists of 100.

A list of 100 items, many of which will probably be repetitions, on a predetermined theme or topic. Repetition is an important part of the process. Topics can be about any current issue (for example: 100 Things I’m Sad About; 100 Things I Need or Want to Do; 100 Places I Would Like to See). At the end of the list, group the responses into themes and synthesize the information.

In this video, Kathleen Adams, Founder of the Center for Journal Therapy, shares what she likes about using short lists as a journaling technique.

7. Alphapoem.

Write the alphabet, A-Z, or any collection of letters, vertically down the side of a page. Then write a poem in which each successive line begins with the next letter. Excellent for groups as it promotes a high level of participation and sharing. Adolescents and reluctant writers respond well.

Check out this example of an Alphapoem:

An Alphapoem on Alphapoems   

by Kay Adams and Scribe (journal group members)                             

A nticipate a B lossoming of                                                          C reative                                                                          D elight!                                                                          E asy, really, once you                                                    F ind the rhythm and the pace.                                                      G ather up the thoughts you                                          H old secret in your heart.                                                I magine them                                                                            J ust drifting out, a                                                                    K aleidoscope of                                                                        L etters                                                                                              M aking words. N o rules to follow–except the O bvious one. P erhaps you’ll find a poet inside? Q uite likely! R ead your Alphapoems; you’ll find them S tartlingly T rue–an U nusual way to give V oice to the W himpers, wonderings, whys, wins. X hilerating feeling to find Y ou’ve reached the Z enith of the poem!

8. Captured Moments.

Vignettes capturing the sensations of a particularly meaningful or emotional experience. Written from the senses with strong descriptors. Captured Moments of beauty, joy, blessing, calm can add balance, hope and perspective to a challenging time.

9. Unsent Letters .

A metaphoric communication to another that is written with the specific intention that it will not be shared.

10. Character Sketch .

A written portrait of another person or of an aspect of the self. Can also be written about emotions by personifying an emotion and giving it a characterization – an appearance, a style of dress, a personality and temperament.

11. Dialogue.

A metaphoric conversation written in two voices. Anyone or anything is an appropriate dialogue partner. There is no constriction by time, space, physical reality or literal voice.

On the page, it looks like a script:

Me:  So how do I do this?

Dialogue Partner:  Just ask me a question, and I’ll respond.

Me:  Seems a little silly.

D.P.:  Just make it up! Write the next thing in your head.

You can write a dialogue with anyone or anything: Your Wise Self, your spouse/partner/child, your job, your body, your feelings, your dreams and desires – anything goes!

12. Perspectives .

An alteration in point of view that provides a different perspective on an event or situation. Through magical realism, we can jump time, compare alternative realities and walk a mile in another’s moccasins. The writer experiences a new dimension of time, place or voice.

  • A different time:  Using imagery, time-travel to a date in the near or distant past or future. Write that altered date at the top of the page. Imagine who you are, how you feel, what is different, how a problem got solved or an issue resolved. Write in the present tense, as if it were that time.
  • A different place:  When faced with a tough choice or decision, jump time and write Perspectives entries in the present tense as if you’d made each choice. One man, conflicted about applying to medical school or a psychology program, saw himself miserable as a psychiatrist and fully engaged as a psychotherapist working with veterans and their families. See what nudges forward from your subconscious mind!
  • A different voice:  Write in someone else’s “I” voice, in the present tense, as if that person were writing in a journal about you or a disagreement (argument, conflict, painful difference) the two of you are experiencing.
  • Another different voice:  Alter your own voice by writing in past tense, in the third-person voice (s/he, her/his), about your own experience. This pulls back the camera lens, puts you in the role of omniscient  narrator/compassionate witness and allows useful distance and objectivity. This is particularly helpful if you are working with difficult stories that can create intense emotional states.

13. Springboard.

A free-write with a prompt. Starting a free-write with the smallest structure of a question, thought or topic can focus and frame the writing session.

Here are some sample springboards:

  • What’s the next thing to do?
  • A year from today, I will ….
  • Why don’t I … ?
  • I’m sorry I didn’t….
  • What am I avoiding?
  • If I knew I would succeed, I would ….
  • I want to overcome….
  • Where am I going?
  • What do I want?
  • If I weren’t scared….
  • What’s the best thing? What’s the worst thing?

In this video, Kathleen Adams, Founder of the Center for Journal Therapy, talks about using props to get started with writing.

14. Free Writing.

Unboundaried, unstructured, unpaced narrative writing. Useful for creative flow or spontaneous writing sessions. Can be structured by adding a time limit or page limit.

(c) Kathleen Adams. All rights reserved. For reprint permission please email us .

Center for Journal Therapy

3440 youngfield st., #411 wheat ridge, co. 80033 phone: (303) 209-9599 contact us >>.

The Beginner’s Guide to Benefits of Journaling and How to Start Writing

Lifelong journalers give us their pro tips.

a young woman is writing on her personal organizer

Our editors handpick the products that we feature. We may earn commission from the links on this page.

Journaling became popular and especially essential for many during the pandemic, and plenty have continued the habit well beyond those days. Living alone and trying to create a routine, publicist Sydney Tillman began journaling daily for the first time in 2020. “It became the thing that would get me out of bed,” Tillman says. Reflecting on her archive of entries, Tillman sees evidence of “growth and progress” during what she called an “awful” year.

The benefits of journaling

Science supports the anecdotal evidence of journaling's positive effect on mental health. According to Elizabeth Gilbert, the head of research at PsychologyCompass , “decades of research” back up the benefits of journaling when it comes to reducing anxiety , easing depression, working through trauma, and setting goals. “If there are stressful things happening in your life, journaling trains you to stop, react, and make sense of it all,” Gilbert says. “Even just make a narrative about it. Tell it in a story in a way that makes sense.”

Bullet Journal Starter Kit

Bullet Journal Starter Kit

For all its purported benefits, though, creating a regular journaling habit can seem daunting for those of us who haven’t been scribbling away since middle school. Starlet Susilo, owner of the boutique stationery company BonBon Paper , says many customers are “overwhelmed” by the possibilities of the blank page—especially given the plethora of beautiful (but ambitious) examples of watercolor-filled bullet journals on blogs and Pinterest.

“Forget about being perfect. Just get started,” Susilo tells customers. “This is just for you. It’s a private experience.” Katherine Smith, a recent college graduate, agrees. “Once I realized my journal was truly for-my-eyes-only content, I was able to really relax into the experience and say what I needed to say for myself within the pages without my inner critic jumping out,” she says.

Given that writing in a journal is such a personal experience, it may take some experimentation to find what works for you (and which type of actual journals you prefer). Below, find some of the best tips and example entries for beginners looking to start a journaling practice, directly sourced from the pros themselves.

Create a writing routine that works for you

Gilbert says to experience the most benefits of journaling, consider writing regular entries. The consistency of the routine matters more than the length of each entry. “Start with a goal for your journaling that feels realistic,” she says.

Ultimately, she recommends making writing a daily practice akin to brushing your teeth. Kadlec, for example, writes at the same time every day: after coffee, but before picking up her phone. Writer Anika Fajardo writes at night. Storyteller and podcaster Micaela Blei writes on the subway.

preview for Bullet Journaling With Inspiration From AmandaRachLee | Artists & Crafts | GH

But don’t punish yourself if you break the schedule

A writing routine is great, but Gilbert cautions against sticking to a dogmatic schedule if it doesn’t feel right, or if there’s simply no time—a sentiment many journalers echo. Alex Stern, a radio producer from Philadelphia, was discouraged from journaling after failing to meet her goal.

“I’d find myself starting off my entries with excuses why I hadn’t written, which aren’t interesting to write or come back to later. I’m more likely to write when I know I don’t have to torture myself through the beginning of the entry explaining where I’ve been,” she says. Now Stern sticks to writing when she feels excited, making sure to do a catch-up entry when necessary.

Make Living Well a Daily Practice with Oprah's The Life You Want™ Planner

Make Living Well a Daily Practice with Oprah's The Life You Want™ Planner

If you’re stumped, use prompts to start your first journal entry

The blank page can be invigorating—or it can be stress-inducing. One way to start the page is with a onetime self-discovery-oriented prompt, or a prompt that you repeat each entry. Susilo offers her customers at BonBon Paper a few techniques when they purchase notebooks.

  • The thank-you note journal: Begin each entry with a sense of gratitude by writing a note of thanks.
  • The future journal: Building on the idea of manifestation , Susilo recommends detailing your dreams, and imagining how it’ll feel when you achieve those goals.
  • The morning show: Each morning, jot down a to-do list, along with any concerns and lingering thoughts. “This frees up your brain to focus on the here and now,” Susilo says.

Jordan Maney , a onetime wedding planner, begins her near-daily entries with a list of five questions: What do I want to do? What do I need to do? Who wants to help me? How do I feel? How can I step outside of my comfort zone today? “For the following journal entry, I’ll answer the questions and respond to the previous ones. Did I do what I wanted?” Maney says.

Or write a new list a day

Journal entries are typically conceived of as being long-form paragraphs, but that doesn’t need to be the case. “It can be intimidating. How do I know what to talk about? Am I supposed to retell the entire conversation first and then say how I feel?” Blei says—which is why she’s taken to writing lists. “Lists can be nonthreatening. They don’t feel like you’re writing an essay or telling every detail of something.”

To begin, Blei recommends placing 10 entries under topics like “Things I’m Feeling Good About” or “Things That Worry Me.”

business woman working at office with documents on his desk, business woman holding pens and papers making notes in documents on the table, hands of financial manager taking notes

Time yourself while writing each entry

Starting a diary entry can be complicated—and so can ending one. Kadlec says beginners might find luck in timing their entries. “If you approach journaling like a mindfulness practice such as meditation , then you only have to do it for two minutes, or five minutes,” Kadlec says. Through this method, people can build a habit in shorter increments.

Try the “morning pages“ method

Julia Cameron’s seminal book The Artist’s Way popularized the concept of morning pages—three daily pages designed to get people in touch with their creative sources. Morning pages are distinguished from typical journal entries by their deliberately stream-of-consciousness writing style, and from when they’re written: always in the morning, ideally in bed just after waking.

For several years, book critic Bethanne Patrick has started her days with morning pages, altered slightly to fit her schedule. “The reason I journal in the morning is because I almost always get somewhere I didn’t expect to get. It’s very powerful. I learn a great deal about myself, which feeds the rest of my day. The morning pages help me center myself,” Patrick says.

Invest in a notebook and pens you like

Paper mate papermate inkjoy pens.

PaperMate InkJoy Pens

Kadlec swears by Moleskines . Stern prefers Leuchtturm journals for their lined pages. Blei likes her minuscule (and hyper-portable) Muji notebooks so much that she called the company's corporate headquarters to order them wholesale. Everyone has a favorite notebook—the key is finding one that works for you.

Need some more shopping inspo? Oprah’s “The Life You Want” Planner makes creating a mindfulness practice both fun and inspiring, while The Wisdom Journal: The Companion to the Wisdom of Sundays, by Oprah Winfrey offers prompts that will ignite a creative fire within you. For a no-frills, budget-friendly notebook that just allows you to put pen to paper, this Amazon Basics pick might be the one for you.

In fact, Smith actually cautions against going for the most beautiful notebook on the shelf. “Leather-bound journals feel too official and dignified for writing my thoughts down. I psych myself out from using them. Pick a journal that you feel comfortable actually using,” she says.

Then find writing utensils that make the process enjoyable. “The nicer the pen, the more fun it is to write,” Fajardo says. For Maney, that means investing in colorful Zebra highlighters , which she uses to mark up past entries. “This sounds corny, but I’ll update myself,” Maney says. “Say I was having a particularly difficult situation with a gentleman. I’ll write, ‘Oh, it all worked out.’”

Moleskine Classic Notebook

Moleskine Classic Notebook

Thick Classic Notebook with Pen Loop

Lemome Thick Classic Notebook with Pen Loop

Leuchtturm1917 Dotted Hardcover

LEUCHTTURM1917 Leuchtturm1917 Dotted Hardcover

Assorted Soft Cover Notebooks

Poppin Assorted Soft Cover Notebooks

A journal can take many forms.

Notebooks are not the only place to record your thoughts. Patrick types her morning pages on her computer and often discards the 600 to 800 words she writes. Tillman uses the Notes app in her phone to catch stray thoughts. Months into the pandemic, Blei began recording audio diaries and leaving messages for her future self. “It works the same way as rereading journal entries, but it’s more intentional,” Blei says.

Keep at it to build the habit

Ultimately, forming a habit requires repetition. Patrick compares her daily writing practice–which she started later in life—to yoga or muscle building. “You don’t get worse,” she says. “You just get better. You’re improving. That’s what journaling does. If you can start a habit like journaling and you can say, ‘Every day, I write,’ what an amazing thing.”

For more ways to live your best life plus all things Oprah, sign up for our newsletter!

Headshot of Elena Nicolaou

Elena Nicolaou is the former culture editor at Oprah Daily. 

graphical user interface, website

Presidents’ Day Deals on Oprah's Favorite Things

tired young woman sleeping on sofa

Is This Why You’re So Tired?

gifts for pregnant women

50 Gifts That Are Perfect for Moms-to-Be

text

Chef Angie Mar on Savoring Success

gifts for women

45 Unique Gifts for Women

a restaurant with lights

Culinary Magic in the Mountains

anxiety, calm, breathing

My 4-Year-Old Taught Me How to Breathe

logo

Vagus Nerve

oprah's the life you want finding your purpose journal

Oprah’s Finding Your Purpose Journal Is On Sale

best gifts for her

The 60 Best Gifts for Her

graphical user interface, text, application

Yes, You Can Unsubscribe from a Friend Group

U.S. flag

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

  • Publications
  • Account settings
  • Advanced Search
  • Journal List
  • J Grad Med Educ
  • v.12(3); 2020 Jun

Academic Writing, and How to Learn How to Write

Marcin kozak.

Associate Professor, Department of Media, Journalism and Social Communication, University of Information Technology and Management, Rzeszow, Poland

I read with great interest the editorial by Yarris and colleagues on academic writing, 1 and I fully agree that academic writing is going to change. It must change, to be true—not only because it should align with technological development, but also because far too often academic texts are unclear, clumsy, and inefficient. We need articles like Yarris et al's and similar initiatives to change this for the better.

A man of the written word, I see academic writing mainly through the prism of actual writing—which does not mean I do not agree with everything else Yarris and colleagues wrote about, because I do. But let me focus on academic writing as an actual writing process. Even if the written word is to be partly replaced with other means, such as visualization, we will continue to write, at least because this is likely the best means of showing what we think . Most visualizations, be it a graph or a table, also show what we think, because they show how we interpret the data: For a given data set, we can often present various charts, offering quite different interpretations. But to show what you think, it's best to write it, even if other measures can help.

The authors emphasize, and I fully agree, that academic writers will have to change their approach to writing, switching from an incomprehensible language full of jargon to an understandable one—and even, I would say, to pleasurable writing. 2 Sad but true, more often than not academic texts are difficult to understand, and the future of academic writing should change that.

To this end, we not only need to put more emphasis on teaching young researchers how to write, but also on convincing not so young ones to further develop their writing skills. While many among the former can be taught, most of the latter would prefer to self-learn. For this, they need to practice, and they need good resources—Yarris and colleagues proposed at least a couple of them. 1

While I really like Stephen King's On Writing 3 and Anne Lamott's Bird by Bird: Some Instructions on Writing and Life , 4 and I love Helen Sword's Air & Light & Time & Space: How Successful Academics Write , 5 these are by no means writing resources. I am afraid that beginning writers starting off with these books would learn what the life of a writer is like, not how to write. Explaining how to organize your work in order to write more, Paul J. Silva also does not offer advice on how to write well. 6

There are quite a few books that do not tell stories about writers and writing, but that show what good writing is and how to write well. Yarris and colleagues provided a perfect example: Helen Sword's Stylish Academic Writing —but unlike the authors stated, it deals with academic, not general, writing. I think academic authors would learn a lot from Thomas S. Kane's The Oxford Essential Guide to Writing 7 and Joseph M. Williams's Style: Ten Lessons in Charity and Grace , 8 both being general writing books; and from Anne E. Greene's Writing Science in Plain English , focused on academic writing, particularly on biology. 9 Let's not forget William Zinsser's On Writing Well: The Classic Guide to Writing Nonfiction , another general writing book of useful advice, very well-known among nonfiction writers. 10 Michael Swan's Practical English Usage 11 might not offer the most pleasant read, since it's a usage guide—but it's known of great usefulness for anyone writing in English.

Of course, these are just my choices. I have enjoyed 20 or 30 other books (by such authors as Roy Peter Clark, Patricia T. O'Conner, Lynne Truss, Constance Hale, June Casagrande, and Mark Forsyth), but the brevity of this letter does not enable me to provide that long a list. If you wish and have the time, find your own favorites, but I would advise beginning with the ones described above.

I have always treated general writing books as more useful than most academic writing ones, for the simple reason that often the latter are too … academic. There are exceptions, though, like the above-mentioned Sword's and Greene's books. I am afraid that too few academics and educators have time to spend on reading about writing. So, unless you are, like me, a rare specimen of a minority population finding pleasure in reading about writing, and do so not only to learn how to write, but also to enjoy your scarce free time—start off with Greene and Sword, and then, if you can, follow with Williams, Zinsser, and Kane.

  • PRO Courses Guides New Tech Help Pro Expert Videos About wikiHow Pro Upgrade Sign In
  • EDIT Edit this Article
  • EXPLORE Tech Help Pro About Us Random Article Quizzes Request a New Article Community Dashboard This Or That Game Popular Categories Arts and Entertainment Artwork Books Movies Computers and Electronics Computers Phone Skills Technology Hacks Health Men's Health Mental Health Women's Health Relationships Dating Love Relationship Issues Hobbies and Crafts Crafts Drawing Games Education & Communication Communication Skills Personal Development Studying Personal Care and Style Fashion Hair Care Personal Hygiene Youth Personal Care School Stuff Dating All Categories Arts and Entertainment Finance and Business Home and Garden Relationship Quizzes Cars & Other Vehicles Food and Entertaining Personal Care and Style Sports and Fitness Computers and Electronics Health Pets and Animals Travel Education & Communication Hobbies and Crafts Philosophy and Religion Work World Family Life Holidays and Traditions Relationships Youth
  • Browse Articles
  • Learn Something New
  • Quizzes Hot
  • This Or That Game New
  • Train Your Brain
  • Explore More
  • Support wikiHow
  • About wikiHow
  • Log in / Sign up
  • Education and Communications
  • Journal Writing

How to Write a Journal

Last Updated: September 18, 2023 Fact Checked

This article was co-authored by Catherine Boswell, PhD . Dr. Catherine Boswell is a Licensed Psychologist and a Co-Founder of Psynergy Psychological Associates, a private therapy practice based in Houston, Texas. With over 15 years of experience, Dr. Boswell specializes in treating individuals, groups, couples, and families struggling with trauma, relationships, grief, and chronic pain. She holds a Ph.D. in Counseling Psychology from the University of Houston. Dr. Bowell has taught courses to Master’s level students at the University of Houston. She is also an author, speaker, and coach. There are 9 references cited in this article, which can be found at the bottom of the page. This article has been fact-checked, ensuring the accuracy of any cited facts and confirming the authority of its sources. This article has been viewed 236,041 times.

Journal writing is a creative form of recording your feelings free from the fear of judgement or criticism. Writing in a journal can allow you to work through complex issues in your life, exploring them thoroughly and candidly. It can also be a way of relieving stress, rather than inadvertently taking out your unexplored feelings on someone else. See Step 1 below to start writing your own journal.

Journal Entry Template

how to learn to write journal

Starting Your Own Journal

Step 1 Find something to contain your journal entries.

  • If you're looking at computer-based options for your journal, you might want to consider starting a blog - essentially an online journal that other people can read . A variety of free blog sites exist, some of which allow you to control who can and cannot read your blog.

Step 2 Start your first entry by setting the scene.

  • If you're writing a blog, you may want to begin by addressing your readers.

Step 3 Write!

  • As an exception to this rule, if you're writing a blog, while you'll want to be open with your emotions, consider your audience. You may want to consider censoring your most intense and/or personal thoughts.

Step 4 Develop a routine.

  • Many journal-writers like to add an entry every night before bed. This is a healthy routine because it allows the writer to relax and unwind at the end of the day by "letting out" any lingering emotions. Be sure to write honestly, don't overthink it, and stay focused.

Step 5 Re-read your past entries for insights.

  • Use your past entries to reflect on your life. As you read, ask yourself questions like, "Am I the same person who wrote this entry?", "Is my life going the way I want it to?", and "How can I work to solve any problems that may have been troubling me when I wrote this entry?"

Step 6 Give your journal some personal style.

  • The experiences you have while travelling can be some of the most influential ones in your life. Discovering the beauty of nature, making a friend in a far-off place, and even simply leaving your home can shape you, so document these things!

Step 8 Customize your journal.

  • If you're using a digital journal, like a blog, try adding photographs to your posts, including links, and choosing colorful templates.

Writing Great Journal Entries

Step 1 Think of your journal as a safe place to express yourself.

  • If you're having trouble turning off your filter, try writing "free form" as an exercise - scrawling your thoughts down in a stream-of-consciousness form the moment they come to you, whether they make sense or not.

Step 3 Comment on past journal entries.

  • For instance, were you in a miserable mood when you wrote yesterday, but are now feeling better? Comment on this! By doing so, you may start to understand why you felt this way in the first place.

Step 4 Use writing prompts when you're bereft of ideas.

  • You may find that, by pursuing a prompt, your writing ventures into interesting new areas you might otherwise never have explored. Be adventurous and pursue these new topics to your heart's content!

Step 5 Learn from the greats!

  • The diary of Samuel Pepys
  • The Diary of a Young Girl (Anne Frank's diary)
  • The diary of Jemima Conduct
  • The diary of Franz Kafka
  • Bridget Jones's Diary
  • Diary of a Wimpy Kid
  • The Color Purple
  • Flowers for Algernon
  • Gentlemen Prefer Blondes

Expert Q&A

Catherine Boswell, PhD

Video . By using this service, some information may be shared with YouTube.

  • Find a secluded and familiar place to write (for example, your bedroom with the door locked), but other secluded places are good too. (Your backyard.) Thanks Helpful 5 Not Helpful 0
  • It's best to write with a pen because pencil can fade. Thanks Helpful 6 Not Helpful 2
  • It's best if it is a secret. It's better if no one reads about your feelings and your secrets. Thanks Helpful 4 Not Helpful 3

how to learn to write journal

  • Always keep it in a safe no-one-knows box of secrets after writing. It's best if it has a lock. Thanks Helpful 84 Not Helpful 7
  • If this person does and reads it, confront them and tell them you absolutely do not want them to read it. Then take necessary precautions, such as getting a notebook with a lock. Thanks Helpful 76 Not Helpful 7
  • Your secrets may be posted around the net if you don't lock it. (This is for blog authors only.) Thanks Helpful 59 Not Helpful 8
  • Someone could find out about your journal. Thanks Helpful 66 Not Helpful 15

Things You'll Need

  • A cheap but good composition notebook.
  • A working pen or pencil.
  • Colouring in pens or pencils.

You Might Also Like

Write a Journal Entry

  • ↑ https://docs.google.com/
  • ↑ https://psychcentral.com/blog/ready-set-journal-64-journaling-prompts-for-self-discovery
  • ↑ https://www.psychologytoday.com/us/blog/mindful-musings/201611/3-reasons-let-yourself-feel-your-emotions
  • ↑ Catherine Boswell, PhD. Licensed Psychologist. Expert Interview. 29 December 2020.
  • ↑ https://www.writersdigest.com/whats-new/7-writing-routines-that-work
  • ↑ https://www.theguardian.com/lifeandstyle/2014/mar/22/how-to-start-journal-writing-drawing
  • ↑ https://www.washingtonpost.com/travel/tips/travel-photos-journal-memories-/
  • ↑ https://www.urmc.rochester.edu/encyclopedia/content.aspx?ContentID=4552&ContentTypeID=1
  • ↑ https://psychcentral.com/blog/ready-set-journal-64-journaling-prompts-for-self-discovery#the-journal-prompts

About This Article

Catherine Boswell, PhD

To write a journal entry, start by writing down the date, time, and location where you're writing. Then, let your emotions flow and write about your feelings, like your family life, crush, or dreams. Try not to overthink it by writing things down as soon as they come into your head. You can also use writing prompts. To make your entries as useful as possible, get into a routine of writing regularly. Then, review your past entries to assess your feelings with the benefit of hindsight. To see a list of some famous journal writers and get tips on how to decorate your journal, read on! Did this summary help you? Yes No

  • Send fan mail to authors

Reader Success Stories

Monica Sharma

Monica Sharma

Apr 11, 2017

Did this article help you?

how to learn to write journal

Adele Hassanieh

Jan 6, 2017

Alexa Mahabir

Alexa Mahabir

Jan 11, 2017

Burhan Dholkawala

Burhan Dholkawala

Feb 5, 2017

Pedra

Aug 22, 2017

Am I a Narcissist or an Empath Quiz

Featured Articles

How to Comfort Someone Physically

Trending Articles

Everything You Need to Know to Rock the Corporate Goth Aesthetic

Watch Articles

Cook Fresh Cauliflower

  • Terms of Use
  • Privacy Policy
  • Do Not Sell or Share My Info
  • Not Selling Info

Don’t miss out! Sign up for

wikiHow’s newsletter

how to learn to write journal

Microsoft 365 Life Hacks > Writing > How to Write Journal Entries

How to Write Journal Entries

No matter what kind of writer you are, journaling can be a valuable tool for keeping track of ideas, developing stories, documenting memories, experimenting with tone in writing , and so much more. Journaling is anything you want it to be—which can make the prospect of starting (or keeping up with) a journal a daunting one.

a person writing notes on a notepad.

Start with this helpful overview of the practice of journal entry writing as it applies to your writing pursuits and some helpful personal journal entry examples, and you’ll find yourself inspired to write in no time.

All your ideas in one place Banner

All your ideas in one place

Keep your thoughts, content, and lists handy with OneNote

What is Journaling?

Simply put, journaling is the act of documenting information—either for the audience of only yourself, or for other readers (like a blog). It can be done daily to keep a brief record of what you’ve done and thought, sporadically as ideas and inspiration come, hand-written, typed—journaling can be almost any kind of writing you’re inspired to do however you’re inspired to do it!

Some journal writers enjoy selecting fun or fancy pens or pencils and the perfect notebook in which to collect their thoughts; others prefer to use a desktop or phone journaling app to jot down notes and lists and story starts. Both are appropriate approaches to crafting personal journal entries. Try a few approaches to journaling until you find the one that feels right for your writing.

What is a Journal Entry—and How Do You Start One?

When you keep a journal, it’ll be comprised of entries. A single journaling session may yield one or several entries in your personal journal.

So how do you start a journal entry?

If you didn’t approach your journal with inspiration on your side, consider putting down whatever your train of thought is in the moment—it may lead you somewhere interesting and unexpected. Or browse your old entries and see if anything takes your attention and sparks a new idea.

Personal Journal Entry Examples

Sometimes all you need to jumpstart your personal journal entries is a prompt. Here are a few examples of personal journal entries to get your pen (or typing fingers) moving:

  • Lists. Lists are a great way to ease into a journal writing session. You can make lists of anything: favorites, likes, dislikes, to-dos, not to-dos—the list, of course, goes on. Your entry may be the list or lists themselves or spark a memory or story idea you’d like to explore in a new entry.
  • Story ideas. Inspiration can strike anywhere. You can make a note of story ideas and return for fleshing it out in a first draft later on or use your personal journal as a place to brainstorm ideas and experiment with new voices, styles, and genres.
  • Daily logs. Some writers enjoy using a journal to keep a daily log of what they did, who they saw, where they went—but in short, brief entries. There’s no right or wrong in your personal journal entries, though, so a log can expand into something longer.
  • Favorite memories. Those memories you find yourself drifting back to often? Put them on the page! Write down as much as you can about those moments—as truthfully or as fictitiously as you’d like.
  • Wish lists and bucket lists. What would you do if you had all the free time in the world? Where would you go? What hobbies would you take up? Who would you like to have dinner with or what theme park would you like to visit? Your journal is the perfect place to explore and document these wants and dreams.

Studies have shown that writing journal entries has myriad benefits beyond deepening your writing practice, including better sleep and boosted self-esteem. 1 To see how others have approached journaling, see if one of your favorite authors have had any of their journals published—you may discover some new topics to explore in your own personal journal entries.

https://www.nytimes.com/2018/10/25/style/journaling-benefits.html

Microsoft 365 Logo

Get started with Microsoft 365

It’s the Office you know, plus the tools to help you work better together, so you can get more done—anytime, anywhere.

Topics in this article

More articles like this one.

how to learn to write journal

Why our keyboard layouts are the way they are

Type sentences quickly by understanding the standard keyboard layout. Learn about the QWERTY keyboard layout and alternative layout options.

how to learn to write journal

When to use cannot versus can not

Cannot or can not? Learn when to use each, master their differences, and boost your writing accuracy.

how to learn to write journal

What is forensic linguistics?

Forensic linguistics is employed by legal authorities to help solve crimes. Understand how forensic linguistics works, and how it benefits the legal system.

how to learn to write journal

Understanding the quibble plot device

Plot devices like quibbles are great tools for enhancing a storyline and keeping readers engaged. Learn what a quibble is and how to use them in your writing.

Everything you need to achieve more in less time

Get powerful productivity and security apps with Microsoft 365

LinkedIn Logo

Explore Other Categories

loading

How it works

For Business

Join Mind Tools

Article • 10 min read

Journaling for Professional Development

Improving yourself through reflection.

By the Mind Tools Content Team

how to learn to write journal

Would you like to become a better communicator, to develop self-awareness, to build self-confidence, and to learn quickly from mistakes, via one simple, daily event? All of this – and more – is possible when you keep a journal.

In this article, we'll explore what journaling can do for you, and how you can fit this valuable habit into your schedule.

Why Journal?

Journaling is simply keeping a record of your thoughts, feelings, and experiences.

It may sound like another task that you'd struggle to fit into a busy schedule, but it need not be a time-consuming chore. In fact, once you get started, you'll likely find it an enjoyable, worthwhile habit.

Calmly recording the details of an event after it happens can provide you with valuable "mental space," allowing you to assess – objectively and dispassionately – what has just occurred.

Journaling can help you to:

  • Identify mistakes that you have made, and reflect on how to avoid them in the future.
  • Review your learning , cementing new concepts in your mind and keeping information fresh.
  • Develop your critical thinking and problem-solving skills.
  • Become more self-aware and emotionally intelligent .
  • Manage stress more effectively.

Journaling can also help you to develop your communication skills, because you get to practice your writing skills, and to learn how to express your thoughts and feelings more clearly.

It can also help you to deal with negative events more effectively. One key study showed that people who used a journal to describe and analyze their emotions after a stressful event felt more positive about it in the long term.

Also, journaling can help you to track your progress toward your goals . It's easier to see what you've accomplished when you record it, which, in turn, can be motivating and fulfilling.

Journaling Examples

You can journal in many ways. Consider these examples:

  • Lachlan updates his journal after attending training classes, to reflect on what he has learned in each session.
  • Marissa records a journal entry each evening after work. She takes time to reflect on what she did well, and she thinks carefully about what she could have done better, especially when it comes to interactions with her team.
  • Michael has felt unfulfilled in his job for several years. He recently began journaling every morning to help him to identify a new purpose in his work.

How to Keep a Journal

There are no strict rules about how to keep a journal. It's a very personal process, and over time you'll likely find your own approach.

If you're new to it, try these seven tips to you get started:

1. Choose a Format

Paper journals are the most common format: many people find that the physical act of "putting pen to paper" helps them to reflect. It's slow and measured, and it can be a valuable way to start or end your day.

Another option is to keep an electronic journal. This could be as simple as keeping a document on your computer, or making entries in a note app such as Google Keep or Evernote. Or, you could use specific journaling apps, such as iDoneThis or Moleskine® Journal.

Our article on The Cornell System offers advice on effective and efficient note-taking, which can help you to recall relevant information and important points.

You could also consider starting a blog , if you feel that your insights could benefit others. Keep in mind, though, that anyone will be able to read your thoughts, feelings, and experiences, so avoid saying anything negative or damaging about your colleagues, clients or organization. Or, set up your blog so that only you can access it.

Alternative formats include keeping video or audio journals , which can work well if you're more comfortable speaking than writing.

If you want to write down your thoughts on paper, buy a notebook or journal that appeals to you visually, as you're more likely to use it.

2. Pace Yourself

Your daily journal entry doesn't have to be a novel! Go slowly at first. Perhaps write for five or 10 minutes, and then stop when you've had enough, or when you feel you have nothing more to say. Over time, you might find that you want to carry on for longer, raising other issues.

Also, try not to amend or censor what you write or say – just let the words (and feelings, emotions, and ideas) flow.

3. Make Journaling a Habit

Journaling is a good habit to have but, like any habit, it takes time and self-discipline to make it stick.

To get the most from your journaling experience, aim to record your experiences at the same time every workday – ideally when you won't be interrupted. First thing in the morning, lunch time, or right before bed are popular times, but the important thing is to work out the best time for you, and to stick to it.

Our articles on Finding Time for Professional Development and Creating Time in Your Day have more information on how you can fit journaling into a busy schedule.

4. Reflect on Your Experiences

Effective journaling combines a clear narrative about recent events with critical thinking about what you've learned – and, perhaps most importantly, what you can change or improve.

To help you to reflect, consider the following questions:

  • What has happened since you last journaled?
  • If you could revisit a recent event, what would you do differently, and why?
  • What have you learned since your last entry?
  • What mistakes have you made, and what has gone well?

Whenever you journal, think carefully about the most important thing that's happened to you since your last entry, and keep in mind that this event can be subtle.

For example, you might have pulled off a great presentation. But, it may be more important to note that you were upset with your assistant before the presentation, and that you snapped unnecessarily. This is the event that you need to record in detail and learn from, exploring why you became upset and why you behaved as you did.

Also, record any quick wins that you've achieved (for example, getting an informative email response), so that they don't slip out of your memory. Reflecting on these can boost your motivation and self-confidence .

And, if you can't think of anything to record in your journal, don't worry. You could just write or say, "I've got nothing to report today" or, "Things were very quiet today," and move on. Chances are, it won't be long before you do have something to report.

Cognitive restructuring is a great technique to use to think about difficult or painful events more objectively. Use it as part of the way that you keep your journal.

5. Be Honest

Try not to "sugarcoat" events as you record them. You'll only learn from your experiences if you're honest about them. Be candid about what you thought, how you acted, or how a person or situation made you feel.

Remember that no-one is reading these words apart from you – unless you're blogging publicly, of course – so there's no need to worry about anyone else's opinion.

6. Focus on Positives and Negatives

Even if you've had a lousy day, try to reflect on at least one positive thing that happened – and the more you can think of, the better. What led to this positive event, and what did you learn?

If you can't identify a positive event, simply "count your blessings" by thinking about things that you're grateful for, such as your health, your skills, or your family.

7. Keep Your Goals in Mind

Think about your long-term goals as you make your journal entry.

What progress have you made since you last added thoughts to your journal, and what can you do next to make progress on your important goals? Did anything happen during your day that could impact those goals? (For example, being handed an unexpected project that will take up a lot of your time.)

You could even kick off your journal by making a list of your goals, and then schedule regular reviews as you progress.

Download and print this journaling aide-mémoire . Cut this out and paste it into your journal as a quick reminder of what you could record.

Journaling is the process of recording your daily thoughts, feelings, and experiences. It offers many benefits for your personal and professional growth.

To begin journaling, decide on a format, and find time (from a few minutes to an hour) in your day to record your entries, so that it becomes a habit.

When you record events in your journal, think critically about what you've experienced, how you could have behaved differently, and what you've learned.

Be honest about your thoughts and feelings. Try to identify at least one positive thing that happened in your day, and reflect on your goals, and your progress toward them.

Download Aide-Mémoire

You've accessed 1 of your 2 free resources.

Get unlimited access

Discover more content

Memory improvement techniques – start here.

Boosting Your Powers of Recall With Mnemonics, Senses and Emotions

Book Insights

Learn Your Way to Success: How to Customize Your Professional Learning Plan to Accelerate Your Career

Daniel Tobin

Add comment

Comments (0)

Be the first to comment!

how to learn to write journal

Enhance your in-demand workplace skills

Top skills - leadership, management, communication and more - are available to develop using the 3,000+ resources available from Mind Tools.

Join Mind Tools today!

Sign-up to our newsletter

Subscribing to the Mind Tools newsletter will keep you up-to-date with our latest updates and newest resources.

Subscribe now

Business Skills

Personal Development

Leadership and Management

Most Popular

Newest Releases

Article aq7esry

The Speed of Trust: The One Thing That Changes Everything

Article az5wyjx

How to Do a Personal SWOT Analysis

Mind Tools Store

About Mind Tools Content

Discover something new today

How to deal with unfair criticism.

Handling harsh or personal criticism calmly and professionally

Unfair Criticism

Taking the Positive From Negative Feedback

How Emotionally Intelligent Are You?

Boosting Your People Skills

Self-Assessment

What's Your Leadership Style?

Learn About the Strengths and Weaknesses of the Way You Like to Lead

Recommended for you

Learning curves.

Improving Efficiency Through Faster Learning

Business Operations and Process Management

Strategy Tools

Customer Service

Business Ethics and Values

Handling Information and Data

Project Management

Knowledge Management

Self-Development and Goal Setting

Time Management

Presentation Skills

Learning Skills

Career Skills

Communication Skills

Negotiation, Persuasion and Influence

Working With Others

Difficult Conversations

Creativity Tools

Self-Management

Work-Life Balance

Stress Management and Wellbeing

Coaching and Mentoring

Change Management

Team Management

Managing Conflict

Delegation and Empowerment

Performance Management

Leadership Skills

Developing Your Team

Talent Management

Problem Solving

Decision Making

You are using an outdated browser. Please upgrade your browser or activate Google Chrome Frame to improve your experience.

FluentU Logo

Language Journal Ideas: What to Write, When to Write and How a Journal Helps You Learn

Journals aren’t just for event-logging, hasty doodles and secret thoughts.

A journal can actually be an invaluable tool on your language learning journey.

The act of writing things down allows you to remember more and track your progress better, among other bonuses.

Read on for six language journal ideas, tips for effective journaling, when you should use your language journal and exactly how the practice will benefit you.

So grab your notebook and let’s begin!

6 Language Journal Ideas for What to Write

1. record milestones on your learning journey, 2. play with new words you’ve learned, 3. look for activities that can become journal entries, 4. compare grammar rules to your native language, 5. write about your thoughts and feelings, 6. write about cultural customs, tips for effective language journaling, include the date and a title, write quickly, reread previous entries, write for “future you”, delve into the details, commit to the practice, when should you use a language journal, why should you keep a language journal, and one more thing....

Download: This blog post is available as a convenient and portable PDF that you can take anywhere. Click here to get a copy. (Download)

What topics have you learned so far? What areas of the language do you have difficulty with? Are there achievements that you should be celebrating with a cone of strawberry ice cream?

Write about them all, no matter how trivial they might seem. They can serve as your entry for the day and also encourage you to move forward.

In addition to personal updates, talk about the milestones you’re working towards as well. What are your language goals? Do you want to tackle prepositions next? Why, and how soon?

The simple act of recording these plans can prevent procrastination.

The best way to remember new vocabulary is to use it. Here are some ideas to play with new words in your journal entries:

  • Write a story or daily diary entry that naturally includes the word(s) you learned that day.
  • Collect word families or words that are related to a certain topic—beverages, for example. In Spanish, for instance, you can easily create a chart or vocabulary list for words like cerveza  (beer), botella  (bottle) and jugo  (juice).
  • Research a single word or phrase that particularly interests you. Maybe it has a nice ring to it, and you like how it’s pronounced. Make it the topic of a whole entry. Research its etymology, usage, synonyms and the different contexts it’s used in.

Go to a local restaurant where they speak your target language and serve its cuisine. Go to a foreign language bookstore and pick something up.  Have coffee with a native speaker . Then write about the experience.

In short, put yourself on the language learning train and watch as future journal entries present themselves to you!

There’s an added benefit here: Not only will this give you more to write about in your journal, but it’ll also get you immersed in your target language in your day-to-day life. You might already know that immersion is one of the quickest and most effective ways to get fluent.

That’s why writing journal entries can be a great strategy to use in tandem with immersive language learning programs . These programs can provide learning content to you in an interactive and memorable fashion, so you won’t have to go searching for topics to write about. 

FluentU takes authentic videos—like music videos, movie trailers, news and inspiring talks—and turns them into personalized language learning lessons.

You can try FluentU for free for 2 weeks. Check out the website or download the iOS app or Android app.

P.S. Click here to take advantage of our current sale! (Expires at the end of this month.)

FluentU Ad

Try FluentU for FREE!

Yes, even grammar can be an interesting topic for your journal!

You can compare the rules with those of your first language. How are they similar or different? Does your native language have an equivalent grammatical mechanism? Are there exceptions to the rules that surprise you?

For example, a Chinese learner might write about how plurals are expressed very differently than they are in English. Or a Romance language learner might simply complain for a page and a half about all the grammatical genders that need to be memorized for every noun.

While standard grammar rules are definitely useful, this act of comparison makes the grammar seem more relevant , more immediate. It’s just a different way of doing things that you’ll master before too long.

Wondering how to learn grammar in a foreign language quickly? Check out these 11 modern strategies that can help you learn grammar and reach fluency quickly. You’ll find…

What did you think about your new language partner? Did you feel a connection? How about that new textbook you bought online—was it everything you thought it would be? Think about the movie you just watched in your target language. Did you like how it ended?

Write about your feelings (in your native language if you need to) and you’ll quickly find out, after a sentence or two, that you only have a cursory knowledge of what you’re actually thinking and feeling. You know you don’t like the textbook you bought… But now ask, “Why?”

Maybe you’ll realize that you don’t like the book because the vocabulary isn’t relevant to your life. Write that down! You’ll then be in a better position to pick materials that actually bring you closer to your goals.

As you get more and more advanced, try to write these entries at least partially in your target language. Don’t be afraid to stop and look up the new words you need to express your full thoughts.

Need some inspiration for your language writing practice? Click here for a list of 33 writing prompts for language learners to get the words flowing. Talk about your…

How many cheek kisses are appropriate when greeting friends in Barcelona? What are the mechanics of bowing in Korea? What gestures should one never make in Italy?

Studying language is inherently tied to learning about culture. So what elements of the target culture surprise you? Do you agree with them? Do you think they’re possible to adopt in your everyday life?

No matter the language you’re studying, its associated culture(s) will have some interesting nuggets that are worthy of a journal entry.

Writing about these things will help you widen your cultural horizon and melt your biases , making you more appreciative of others. And if that’s the only benefit you get while maintaining a language journal, it’ll still be worth it.

But you already know there’s more to it than that.

Just knowing there’s a wonderful culture and an awesome group of native speakers behind the language gives you more motivation to work towards fluency .

Language and culture are intrinsically connected. By learning about the history of the language, how it has evolved over time and how it is used, you’ll be able gain a…

You already know why it’s important to date your entries, right? If you don’t, you’ll never be able to piece together your language journey, especially if you decide not to write every day.

Dates are important because they’re timestamps of your progress. They let you know the chronology and pace of your learning.

While you’re at it, why not include the exact time you started writing? When you read the entry later, the time will take you back to that exact moment!

Many people don’t bother with titles, but they actually make your entries more interesting. An entry titled: “Why I Hate the Spanish Word Con (With)” will clickbait you into re-reading your experience and re-learning along the way.

Plus, titles really come in handy when you’re looking for a specific entry. They’re great time savers, so try to make your titles highly descriptive of the content for that day.

Silence the inner critic, the grammar fascist, the perfectionist who wants every word and every line to be perfect. Don’t get sidetracked with making the words fancy or thinking up a synonym for a common phrase. Just get in there and write!

Writing fast, without regard for aesthetics, allows you to capture your thought bubbles before they burst and disappear. Know that there’s no judge, no penalty and no contest. Erasures are fine. Scribbling fonts can be forgiven.

Plus, a fast first draft gives you a great opportunity to self-correct afterwards and catch your bad habits.

If you want a clean copy of your work, you might want to start with a loose piece of paper to write the draft. Transfer it to your journal once you’ve made your corrections.

For those of you who decide to keep things digital in the first place, muddled scribblings might never be an issue. Check out Penzu  and Day One for some online journaling options.

As noted earlier,  writing is just the first part of the process. You need to review your entries, and often!

Each time you leaf through the pages, something new will jump out at you—a mistake you didn’t catch before, different words you’d use this time, or just a new way of looking at things.

Don’t wait for three months before you start re-reading what you’ve written. You might even write a reaction to what you’ve written , say, a week ago.

Or, did you journal about a language question or point of confusion previously? Address it in a different entry now that you know better!

Writing a journal is like talking to yourself.

There’ll come a time when you re-read some of your entries and you won’t know what the heck you’re talking about. So you need to give your “future self” some context on the issue or topic you’re writing about.

If the entry is about why you’re changing French tutors, for example, then give some clear reasons why you’re doing so. “Future you” may have forgotten just how frustrating it felt when the first tutor failed to show up on Skype.

If your entry is about a grammar question, try to state your question as explicitly as possible—not just a broad complaint like, “the past tense is so confusing!”

Make your entries highly immersive. That means talking about what you see, hear, feel, taste and smell.

Let’s say you’re talking about the productive time you’ve had learning Italian while waiting in line for coffee. Write how devastatingly cold you were while flipping through your flashcards. Then talk about how warm and toasty you felt once you finally got in and were greeted by the rich aroma of your favorite brew.

These lines don’t directly correlate with language learning, but they do punch up your entries. And you’ll be learning words you know you actually use.

If you can, write the whole entry in your target language to test your vocabulary and stretch your writing skills.

This one’s a biggie! A journal is a commitment.

I don’t want to scare you from starting one. Instead, I want to let you know that this is one of life’s activities that always gives back.

The time you put into maintaining a journal will always be worth the benefits you get from it. The rewards include a better understanding of yourself, a better understanding of the target language and a better idea of what works for you as a language learner.

Let’s say two people decide to learn Mandarin . They’re both starting from scratch and using the same learning material. But one decides to maintain a journal, while the other doesn’t. I’d wager my final dollar that the former will have a faster, more rewarding language learning experience.

Should you write daily? Three times a week? Only when the mood strikes you?

Ultimately, it’s a personal decision based on your goals and schedule. That said, there’s an argument for treating journal entries like fresh bread—made daily.

There are lots of benefits to journaling. (See the next section for exactly what they are.) Wouldn’t you want to enjoy those benefits on a daily basis, instead of just once or twice a week? Daily journaling lets you grapple with language concepts when they’re still fresh.

The danger of waiting for the writing bug to bite is that it may never come. And when it does, you may have already forgotten what you wanted to write about. Doing short daily entries gives you a more detailed record of your progress.

What did you learn today? Write about it! Even for just five minutes. Don’t worry if it seems insignificant. Seven seemingly insignificant entries a week will snowball quickly.

Daily journaling also builds positive study habits. If you’re writing five minutes every day, you’re also telling yourself on some level, “Man, I need some study time!” Because what’ll you write about when you haven’t even cracked that German book in weeks?!

Still not convinced you should pick up the journaling practice? Let me lay out exactly what it’ll do for you.

First of all, a language journal gives you a space to express your anxieties, thoughts and insights as you’re learning.

The language learning path is never a straight one . It has curves, rough patches and bumps from time to time. Writing is cathartic, and your journal can become your emotional outlet during the ups and downs.

Deathly afraid of talking to native speakers? Well, why don’t you write about it? And when you know that the fear is there, maybe you can then do something positive about it.

Second, a journal is great for language review. Besides serving as a written record of your day and your musings (much like a diary) a journal can also be topical in nature.

Consider a scientist who writes about what happens in the lab. For example, Marie Curie’s journals are full of notes on her discoveries about radioactivity. (In fact, her notebooks are kept in lead-lined boxes because they’re still radioactive!)

For our use, a journal need not be so dramatic. You’ll be doing language-related entries, writing about words and phrases you find interesting, grammar rules that defy explanation or cultural tidbits that push the limits on what you thought was normal. When you read the entries at a later date, they’ll serve as a great review for everything you’ve learned.

Third,  the very act of writing itself serves as a memory-enhancing exercise . It gives you a closer relationship to the material and it’s an extra layer of processing that your brain goes through.

Want to see language journals in action? You can listen to YouTubers Lindie Botes and Tanya Benavente discuss their own journals and get a peek inside the pages.

Journaling is your partner in language learning. The time and effort you put into it will be richly rewarded.

So, go right ahead— start keeping a journal today . Use the language journal ideas in this post to help you get started. Happy writing!

If you dig the idea of learning on your own time from the comfort of your smart device with real-life authentic language content, you'll love using FluentU .

With FluentU, you'll learn real languages—as they're spoken by native speakers. FluentU has a wide variety of videos as you can see here:

learn-a-language-with-videos

FluentU App Browse Screen.

FluentU has interactive captions that let you tap on any word to see an image, definition, audio and useful examples. Now native language content is within reach with interactive transcripts.

Didn't catch something? Go back and listen again. Missed a word? Hover your mouse over the subtitles to instantly view definitions.

learn-a-language-with-music

Interactive, dual-language subtitles.

You can learn all the vocabulary in any video with FluentU's "learn mode." Swipe left or right to see more examples for the word you’re learning.

learn-a-language-with-adaptive-quizzes

FluentU Has Quizzes for Every Video

And FluentU always keeps track of vocabulary that you’re learning. It gives you extra practice with difficult words—and reminds you when it’s time to review what you’ve learned. You get a truly personalized experience.

Start using the FluentU website on your computer or tablet or, better yet, download the FluentU app from the iTunes or Google Play store. Click here to take advantage of our current sale! (Expires at the end of this month.)

Enter your e-mail address to get your free PDF!

We hate SPAM and promise to keep your email address safe

how to learn to write journal

How to Write a Learning Journal

Sophie levant.

A learning journal tracks your academic success and struggles.

A learning journal is an excellent tool for any serious student. By creating a record of what you have learned, you are better able to make connections with previous knowledge, to understand the obstacles that go into acquiring that knowledge and to chart your own intellectual development and personal growth.

Choose your journal. This can be anything from a composition book to a leather-bound diary, as long as you find it inviting enough to write in.

Pick a quiet time and place to write, free of pressing obligations and distractions. Remember that this is a special time for you to reflect on yourself, not the laundry or the electric bill.

Follow a consistent format. Although there is no strict way to keep a learning journal, it may help you to have that structure to guide your writing. You might begin your entry by first describing what you are learning.

Talk about any factors affecting the learning process. Are you studying alone or in a group? How does this alter your understanding? Did you come to this subject on your own, or was it assigned?

Write down your feelings about and reactions to what you are studying. Do you agree or disagree? How have your assumptions been challenged? What has inspired you? Note any quotes or concepts that intrigue you. It's helpful to have your learning materials and notes close by for this purpose.

Reflect on what you have learned from the experience, and place it within a larger context. How have you gotten to this point? What can you do to improve in the future? How can you use what you have learned, and how does it relate to anything else?

  • For a successful learning journal, write as frequently as you can manage and make it a habit.
  • 1 Infed: Writing and Keeping Journals

About the Author

Sophie Levant is a freelance writer based in Michigan. Having attended Michigan State University, her interests include history classical music, travel, and the German language. Her work has been published at eHow and Travels.

Related Articles

How to Write a Narrative Journal

How to Write a Narrative Journal

Can You Erase a Comment on Instagram?

Can You Erase a Comment on Instagram?

How to Sync Contacts Between an iPad & an iPhone Without a Mac

How to Sync Contacts Between an iPad & an iPhone Without...

How to Erase Highlighters

How to Erase Highlighters

How to Study the Bible Effectively

How to Study the Bible Effectively

How Good of a Friend is Your BFF?

How Good of a Friend is Your BFF?

How to Recover a Facebook Status Update That Didn't Post Correctly

How to Recover a Facebook Status Update That Didn't...

How to Write a Lecture Report

How to Write a Lecture Report

How to Start a Secret Society

How to Start a Secret Society

How to Create an Outline for a Reflection Paper

How to Create an Outline for a Reflection Paper

How to Cast a Full Moon Wish Spell

How to Cast a Full Moon Wish Spell

How to Properly Read a Book

How to Properly Read a Book

How to Study Effectively

How to Study Effectively

How to Get Notes off an Old iPhone to a Computer

How to Get Notes off an Old iPhone to a Computer

How to Use a Dake Bible

How to Use a Dake Bible

How to Sync OneNote With iPhone

How to Sync OneNote With iPhone

How to Place Captain Bars

How to Place Captain Bars

Note Taking Method for More Effective Studying

Note Taking Method for More Effective Studying

How to Take Pen Stains Out of a White Sweater

How to Take Pen Stains Out of a White Sweater

How to Set Goals Spiritually

How to Set Goals Spiritually

Regardless of how old we are, we never stop learning. Classroom is the educational resource for people of all ages. Whether you’re studying times tables or applying to college, Classroom has the answers.

  • Accessibility
  • Terms of Use
  • Privacy Policy
  • Copyright Policy
  • Manage Preferences

© 2020 Leaf Group Ltd. / Leaf Group Media, All Rights Reserved. Based on the Word Net lexical database for the English Language. See disclaimer .

How a gratitude journal can make life more meaningful

Gratitude journals are a place for individuals to write down and ponder the positive occurrences of everyday life, no matter how “small” they might seem. Focusing on positive experiences may make it easier to appreciate life's gifts and develop a more profound sense of gratitude.

After creating a gratitude journal, you might be more satisfied with your life and more adept at navigating challenges over time. For this reason, it may be helpful to learn how to make one of these journals and how it may bring meaning to your life. 

What is a gratitude journal?

A gratitude journal is a particular type of journal used to recognize and write down positive experiences consciously and what you are grateful for. It can be any device or item that lets you keep a record, like a traditional paper notebook, a digital app on your smartphone, or a document on your computer. 

A gratitude journal involves regularly thinking about and writing down what you're thankful for. The main goal of a gratitude journal is often to encourage a change in your mindset, helping you focus on the positive aspects of life.

You can customize your gratitude journal to fit your preferences. That way, you can express yourself creatively and make the process more engaging. Some people like using templates or structured prompts to guide their journaling, while others may prefer writing freely without any restrictions. If you don’t enjoy writing, you might try an audio or video journal on your smart device. 

Insights from happiness studies: The benefits of gratitude

Happiness studies have increasingly focused on the role of gratitude in promoting more significant happiness and life satisfaction. One major finding is that practicing gratitude through activities like gratitude journaling may lead to  numerous mental health benefits . Studies have found that writing down what you’re thankful for may improve sleep, lower stress, and strengthen relationships.

In another major study, nursing students who participated in activities that promoted gratitude and kindness were shown to have improved  well-being and mental health . Interventions to encourage gratitude may include using web-based or paper-based lists to write down what you feel grateful for.

Positive effects of keeping a gratitude journal

Keeping a gratitude journal may have multiple positive effects on your life. By writing down what you’re thankful for every day, you may be more likely to lead a meaningful and fulfilling life.

There are several potential benefits of keeping a gratitude journal, including but not limited to the following: 

  • Increased happiness: Recognizing and focusing on the positive aspects of life may help boost overall happiness and contentment.
  • Improved interpersonal relationships: Acknowledging the value of the people in your life may lead to stronger connections and empathy towards others.
  • A less materialistic mindset: Focusing on non-material sources of joy and fulfillment may reduce unnecessary buying habits and promote appreciation for what you already have.
  • Improved language and writing skills: Regularly expressing thoughts and feelings in written form may improve your ability to convey emotions to others.
  • Improved physical health: Those who maintain an attitude of gratitude may have better physical health, potentially due to lower levels of stress and a greater motivation to maintain healthy habits.
  • Increased self-esteem: By recognizing personal victories and positive experiences, you may better appreciate your achievements and strengths.

These are a few of the possible benefits of a gratitude journal. It may take some time to experience the full benefits of a gratitude journal. Staying consistent in your practice of writing in a gratitude journal can help you gain further benefits and become comfortable with this practice. 

How to keep a gratitude journal: Tips and techniques

Keeping a gratitude journal may benefit your overall well-being by introducing elements of positive psychology into your daily routine. It's often considered a straightforward process that may boost your emotional and mental health. Below are a few tips and techniques to help you maintain a gratitude journal:

  • Be Consistent: You may want to write regularly, such as once or twice a week. Research has shown that this frequency is sometimes more beneficial than  journaling every day.
  • Choose the Right Format: Whether it's with traditional paper and pen, a digital journal, or a Word document, pick the method that best suits you.
  • Reflect on the Positive Aspects of Life: By focusing on positive emotions and experiences, you may develop a more significant sense of self-awareness and learn to appreciate the positive in life.

By incorporating the above tips into your journaling practice, you may gain important insights into your life, shift your perspective, and develop a habit of recognizing and appreciating daily positive events. 

Consider these additional practices for a potentially richer journaling experience:

  • Focus on the Quality of Gratitude Over Quantity: Instead of trying to list as many items as possible, delve deeply into a few aspects of gratitude.
  • Savor Unexpected or Surprising Events: These may evoke stronger feelings of gratitude.
  • Incorporate Variety: Avoid repeating the same topics in every entry to keep your journaling fresh and exciting.

Maintaining a gratitude journal with support

While writing in a gratitude journal has potential benefits, it may be even more helpful when combined with therapy. However, some individuals may be uncomfortable meeting with a provider in person. In these cases, an online therapist can help clients explore gratitude beyond journaling and apply it to various aspects of their lives. 

Online therapy may also help clients manage mental health challenges that could benefit from gratitude journaling. Studies have shown that online therapy can be as effective as in-person therapy  for various mental health conditions, including depression and anxiety. 

Online therapy is often flexible and convenient for clients. They may share their gratitude journals with their therapists, who can often provide personalized advice and feedback on effective journaling techniques. In addition, online therapy platforms like BetterHelp often provide access to a wide range of licensed professionals experienced in various therapy approaches, including gratitude journaling.

Gratitude journaling is a potentially powerful tool that encourages individuals to focus on the positive aspects of their lives. By regularly writing down events, people, and items you're grateful for, you might experience a more positive outlook and an improvement in your mental health. 

Consider setting aside time each day for reflection when starting a gratitude journal. Stay consistent and remember that it's a personal experience–there's no right or wrong way to journal about gratitude. As you stick to gratitude journaling, you may notice a shift in your mindset, which may allow you to develop a greater overall sense of happiness.

The impact life events can have on your mental health

Looking at the science behind gratitude and its effects on mental health, seeking to improve your mental health, top categories.

  • Relationships and Relations

Yahoo Life

Journaling can have major benefits — but it's not for everyone. Here's what to do if you're struggling to write down your thoughts.

I n the months after her college graduation, Pennsylvania-based TikToker Cheyenne Livelsberger , 22, turned to journaling . As someone who struggles with anxiety , Livelsberger found the process to be a “great outlet,” causing her to feel “lighter” once she put her feelings to paper.

“These brain dump sessions help ground my thoughts and provide prospective,” says Livelsberger, who has amassed more than 200,000 followers on TikTok thanks, in part, to her journaling content. “I also practice gratitude through my writing as well, which has made me extremely appreciative of all the small but beautiful moments of life.”

California resident Maddie , 20, started journaling in early 2023 at the recommendation of her therapist. Though it initially took some experimentation, she ultimately found that journaling came with plenty of mental health benefits, like helping her reflect on the positive aspects of her life and process her different moods.

“I've always been someone who has to process things by writing them down, and doing this helps me feel more confident in expressing myself verbally,” Maddie, who now uses her TikTok to share her prompt-inspired journaling process with her more than 36,000 followers, explains to Yahoo Life. “It also is a great mechanism for calming me down in a heightened state.”

The hashtag #Journaling has more than 7.7 billion views on TikTok, and many people — like Maddie and Cheyenne — say the practice is a useful tool when it comes to managing their mental health . Experts agree that writing down your thoughts can be a powerful exercise — though, as with many mental health modalities, it may not be for everyone. Here’s what to know.

How journaling can help you manage your mental health

The most common type of journaling involves writing down not just a list of one’s daily activities, but also a reflection on the thoughts and emotions that come up during the day. Clinical psychologist Sabrina Romanoff tells Yahoo Life that a benefit of a journaling practice is that it can help you escape the loop of “vicious thought cycles,” by encouraging you to reflect on your reactions to situations instead of “catastrophizing in an unhelpful way.”

“Writing creates distance to consider your thoughts in a more objective way,” she explains. “Oftentimes we approach our thoughts as facts, which can get us into trouble when we believe our most anxiety-provoking thoughts without hesitation. The process of reading a biased thought outside of your mind can provide an alternative outlook and see things more clearly.”

Therapist Shari Foos, who created The Narrative Method , a nonprofit organization that helps people connect through creative programs, notes that journaling can help you “develop a listening relationship with yourself." Having a regular practice of self-discovery can also help you see how the past affects your present, she adds, which can lead to more self-confidence and help journalers face challenges more easily.

Mental health expert Katelyn Lehman, co-founder of the Quantum Clinic , says that journaling can also remind you of the good things in life, especially if your practice includes writing down what you are grateful for. “If you do that regularly and consistently, you can go back at the end of the month and read back on all the things you’re grateful for,” she says. “If you're someone who deals with a lot of stress and anxiety or uncertainty about your life, it allows you to reflect on and really internalize those things.”

Ultimately, she says, journaling can help you see the things that are coming up for you, as well as those that aren’t working for you. “That's what journaling does,” she explains. “It allows you to connect to your answers in a way that maybe you might not otherwise.”

What if journaling just isn’t your thing?

Experts agree that there’s no harm in trying journaling, and that it may take some time for you to get comfortable with the practice. Maddie, for example, says that she only started getting excited about journaling when she started using prompts to write. Her method includes picking a question (such as “When do you feel most like yourself?”) and writing to answer it, rather than allowing thoughts to flow freely without any structure.

Foos says it’s important to recognize the difference between feeling frustrated in the moment, and not liking the writing process . In fact, that frustration can even be incorporated into your journal, says Foos; it’s OK to “give voice” to the doubts you feel by writing them down. She also recommends giving yourself a month before coming to conclusions about whether or not to continue. “If you do decide to stop journaling, try not to come to any permanent conclusions about it,” she says.

If writing down your thoughts isn’t something you connect with, you could try a different approach, adds Lehman, who favors “art journaling.” This is big on social media as well: Many people use their journals as scrapbook-type art projects, incorporating different creative materials into the practice. According to Lehman, journaling is all about allowing "yourself to express what’s coming through for you" — and there’s no right or wrong way to approach it.

Lehman adds that people might feel frustrated if they feel like they must journal every day in order to reap the benefits. While many people enjoy a daily journaling practice, she herself has maintained an “irregular journaling practice” over the last 20 years, In which she may pick up her notebook only a few times a month. She still sees the benefit of journaling, however, because over many years, she can “review patterns that come up for myself over a lifetime.”

“There’s no regimen for this practice,” she says. “It's really about doing what works best for you.”

Why some people love journaling, and what to try if you don't. (Getty Creative)

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • View all journals
  • My Account Login
  • Explore content
  • About the journal
  • Publish with us
  • Sign up for alerts
  • Open access
  • Published: 12 February 2024

A conserved interdomain microbial network underpins cadaver decomposition despite environmental variables

  • Zachary M. Burcham 1 , 2 ,
  • Aeriel D. Belk 1 , 3 ,
  • Bridget B. McGivern   ORCID: orcid.org/0000-0001-9023-0018 4 ,
  • Amina Bouslimani 5 ,
  • Parsa Ghadermazi 6 ,
  • Cameron Martino 7 ,
  • Liat Shenhav 8 , 9 , 10 ,
  • Anru R. Zhang 11 , 12 ,
  • Pixu Shi 11 ,
  • Alexandra Emmons 1 ,
  • Heather L. Deel 13 ,
  • Zhenjiang Zech Xu   ORCID: orcid.org/0000-0003-1080-024X 14 ,
  • Victoria Nieciecki   ORCID: orcid.org/0000-0002-1891-5909 1 , 13 ,
  • Qiyun Zhu   ORCID: orcid.org/0000-0002-3568-6271 7 , 15 , 16 ,
  • Michael Shaffer 4 ,
  • Morgan Panitchpakdi 5 ,
  • Kelly C. Weldon 5 ,
  • Kalen Cantrell   ORCID: orcid.org/0000-0002-6262-1668 17 ,
  • Asa Ben-Hur 18 ,
  • Sasha C. Reed 19 ,
  • Greg C. Humphry 7 ,
  • Gail Ackermann 7 ,
  • Daniel McDonald 7 ,
  • Siu Hung Joshua Chan   ORCID: orcid.org/0000-0002-7707-656X 6 ,
  • Melissa Connor 20 ,
  • Derek Boyd   ORCID: orcid.org/0000-0003-1444-0536 21 , 22 ,
  • Jake Smith 21 , 23 ,
  • Jenna M. S. Watson 21 ,
  • Giovanna Vidoli 21 ,
  • Dawnie Steadman   ORCID: orcid.org/0000-0003-0812-0739 21 ,
  • Aaron M. Lynne 24 ,
  • Sibyl Bucheli 24 ,
  • Pieter C. Dorrestein   ORCID: orcid.org/0000-0002-3003-1030 5 ,
  • Kelly C. Wrighton 4 ,
  • David O. Carter   ORCID: orcid.org/0000-0003-1885-5237 25 ,
  • Rob Knight   ORCID: orcid.org/0000-0002-0975-9019 7 , 17 , 26 , 27 &
  • Jessica L. Metcalf   ORCID: orcid.org/0000-0001-8374-8046 1 , 13 , 28  

Nature Microbiology ( 2024 ) Cite this article

8335 Accesses

1 Citations

414 Altmetric

Metrics details

  • Microbial ecology

Microbial breakdown of organic matter is one of the most important processes on Earth, yet the controls of decomposition are poorly understood. Here we track 36 terrestrial human cadavers in three locations and show that a phylogenetically distinct, interdomain microbial network assembles during decomposition despite selection effects of location, climate and season. We generated a metagenome-assembled genome library from cadaver-associated soils and integrated it with metabolomics data to identify links between taxonomy and function. This universal network of microbial decomposers is characterized by cross-feeding to metabolize labile decomposition products. The key bacterial and fungal decomposers are rare across non-decomposition environments and appear unique to the breakdown of terrestrial decaying flesh, including humans, swine, mice and cattle, with insects as likely important vectors for dispersal. The observed lockstep of microbial interactions further underlies a robust microbial forensic tool with the potential to aid predictions of the time since death.

Decomposition is one of Earth’s most foundational processes, sustaining life through the recycling of dead biological material 1 , 2 . This resource conversion is critical for fuelling core ecosystem functions, such as plant productivity and soil respiration. Microbial networks underpin organic matter breakdown 3 , yet their ecology remains in a black box, obscuring our ability to accurately understand and model ecosystem function, resilience and biogeochemical carbon and nutrient budgets. While DNA-based assessments of decomposer microbial communities have occurred in plant litter 4 , 5 and a few in mammals 6 , 7 , little has been revealed about the microbial ecology of how decomposer microbial communities assemble, interact or function in the ecosystem. Our understanding of how animal remains, or carrion, decompose is in its infancy due to the historical focus on plant litter, which dominates decomposing biomass globally. Nevertheless, an estimated 2 billion metric tons of high-nutrient animal biomass 8 contribute substantially to ecosystem productivity, soil fertility, and a host of other ecosystem functions and attributes 9 , 10 . Carbon and nutrients from carrion biomass can be consumed by invertebrate and vertebrate scavengers, enter the atmosphere as gas, or be metabolized by microbes in situ or via leachate in the surrounding soils 11 , 12 . The proportion of carrion carbon and nutrients entering each resource pool is not well quantified and probably highly variable with substantial contributions to each at an ecosystem scale 2 , 13 . Unlike with plant litter, which is primarily composed of cellulose, animal decomposers must predominantly break down proteins and lipids, which require a vastly different metabolic repertoire. How microbial decomposers assemble to break down these organic compounds is not well understood. For plant litter, it has been proposed that functional redundancy allows different communities of microbes to assemble in any given location 14 and perform similar functions. Alternatively, similar microbial community members, or microbial networks, may assemble across sites to outcompete other community members and thrive on nutrients 15 .

Recent research has demonstrated that microbial community response over the course of terrestrial human cadaver decomposition and across a range of mammals, results in a substantial microbial community change through time that is repeatable across individuals 6 , 7 , 16 , 17 , 18 and appears somewhat similar across different soil types 6 and robust to scavenger activity 16 . These data suggest the potential for universal microbial decomposer networks that assemble in response to mammalian remains. However, it remains unclear how the effects of environmental variability, such as differences in climate, geographic location and season, may affect the assembly processes and interactions of microbial decomposers. Yet understanding and predicting this assembly is important for our understanding of ecosystems and informs practical applications. For example, profiling microbial succession patterns associated with human remains may lead to a novel tool for predicting the postmortem interval (PMI), which has critical societal impact as evidence for death investigations. Within laboratory experiments 6 , 18 , as well as field experiments in single locations 6 , 19 , microbial decomposer community succession is closely linked to PMI at accuracies relevant for forensic applications 6 , 17 , 18 , but these studies do not inform questions of microbial variation across sites, climates and seasons. Consequently, a robust understanding of how microbial ecological patterns of mammalian, and specifically human, decomposition vary is critical for using and improving these important forensic tools. Unlocking the microbial ecology black box for mammal decomposition, or more generally carrion decomposition, could provide actionable knowledge for innovation in agriculture and the human death care industry (for example, composting of bodies) 20 , sustainability (for example, animal mass mortality events) 21 and the forensic sciences (for example, estimating PMI) 22 , as well as guide future research on plant decomposition and maintaining global productivity under anthropogenic change.

To address ecological and forensic research questions on decomposer network assembly and function, we used three willed-body donation anthropological facilities in terrestrial environments across two climate types within the United States (Fig. 1a and Extended Data Fig. 1a,b ) 23 . We asked whether temporal trends in microbial decomposer communities that we previously characterized in a limited experiment using human cadavers at a single geographic location 6 were generalizable across climate, geographic locations and seasons. Over the course of decomposition, we compared the microbial response to decomposition across 36 human bodies within (temperate forest) and between (temperate forest vs semi-arid steppe) climate types. We used multi-omic data (16S and 18S ribosomal (r)RNA gene amplicons, metagenomics and metabolomics) to reveal microbial ecological responses to cadaver decomposition over the first 21 d postmortem (Fig. 1b and Extended Data Fig. 1c ), when decomposition rates are generally fast and dynamic (Fig. 1c , metadata in Supplementary Table 1 ). Here we show that a universal microbial decomposer network assembles despite location, climate and seasonal effects, with evidence of increased metabolic efficiencies to process the ephemeral and abundant lipid- and protein-rich compounds. Key members of the microbial decomposer network are also found associated with swine, cattle and mouse carrion 16 , 24 , 25 , 26 , suggesting that they are not human-specific, but probably general to mammal or animal carrion. Furthermore, the universal microbial network communities underlie a robust microbial-based model for predicting PMI.

figure 1

a , Köppen–Geiger climate map showing ARF and STAFS as ‘temperate without a dry season and hot summer’ and FIRS as ‘arid steppe cold’ adapted from ref. 23 . Thirty-six cadavers in total were placed ( N  = 36), 3 per season for a sum of 12 at each location. b , Upset plot representing the experimental design for the total sample size ( x axis) and number of shared/paired samples ( y axis) for each data type. MetaG, metagenomics; Metab, metabolomics; 18S, 18S rRNA amplicon; 16S, 16S rRNA amplicon. c , Total body score, a visual score of decomposition calculated over the course of decomposition 27 , illustrating how decomposition progresses at each location and by season in triplicate. Dashed lines separate sections of early, active and advanced stages of decomposition as determined by a temperature-based unit of time, accumulated degree day (ADD), calculated by continuously summing the mean daily temperature above 0 °C from left to right. Point transparency increases with days since placement.

Source data

Nutrient-rich cadaver decomposition.

Terrestrial mammalian decomposition is a dynamic process that is partly governed by environmental conditions 1 , 2 . We observed that cadavers placed in the same climate (temperate) decomposed similarly across locations within a season, as determined by a visual total body score (TBS) of decomposition progression (Fig. 1c ) 27 . Cadavers placed in a semi-arid climate (that is, FIRS) generally progressed more slowly through decomposition over the 21 d, which is probably due to decreased temperatures, humidity and precipitation in the semi-arid environment (Extended Data Fig. 1a,b ) 9 , 28 . We observed visual cadaver decomposition progression to be impacted by season, wherein summer was the most consistent across locations (Fig. 1c ). As cadavers and mammalian carrion decompose, they release a complex nutrient pool that impacts the surrounding environment, often resulting in the death and restructuring of nearby plant life 2 , 29 due to generally high inputs of nitrogen 2 , 6 , 9 , 30 , 31 , which is primarily in the form of ammonium 6 , as well as carbon 2 , 6 , 10 , 30 , 31 and phosphorous 9 , 29 . We characterized the cadaver-derived nutrient pool via untargeted metabolomics using liquid chromatography with tandem mass spectrometry (LC–MS/MS) data. Cadaver skin and associated soil metabolite profiles were distinct (Extended Data Fig. 2a,b ). Overall, profiles were largely dominated by likely cadaver-derived lipid-like and protein-like compounds, along with plant-derived lignin-like compounds (Extended Data Fig. 2c,d ). As decomposition progressed, both cadaver-associated soil and skin profiles became enriched in linoleic acids, aleuritic acids, palmitic acids, long-chain fatty acids, fatty amides and general amino acids (Supplementary Tables 2 and 3 ). Furthermore, we estimated a reduction of thermodynamic favourability in the nutrient pool at all locations (Extended Data Fig. 2e,f ), a similar pattern found in the microbial breakdown of plant material in soils 32 . These data suggest that during the first weeks of decomposition, more recalcitrant lipid-like and lipid-derivative nutrients build up within soils as decomposers preferentially utilize labile protein-like resources, but with climate-dependent abundance variations in lipid-like (Extended Data Fig. 2g ) and geographic-dependent variations in protein-like compounds (Extended Data Fig. 2h ). These patterns may also be influenced by the physical properties of soil at each location such as texture, density and stoichiometry.

Cadaver microbial decomposer assembly

The lipid- and protein-rich cadaver nutrient influx is a major ecological disturbance event that attracts scavengers from across the tree of life and initiates the assembly of a specific microbial decomposer community. On the basis of our metabolite data, we hypothesized that soil decomposer microbial communities preferentially shift to efficiently utilize more labile compounds (for example, amino acids from proteins and possibly also carbohydrates such as glycogen, which were not detected via LC–MS/MS metabolomics) and temporarily leave the less-labile compounds (for example, lipids) in the system. By building a metagenome-assembled genome (MAG) database from human decomposition-associated soils (Extended Data Fig. 3a,b and Supplementary Tables 4 – 6 ), we reconstructed genome-scale metabolic models to characterize how potential metabolic efficiencies of soil microbial communities shift in response to three major resources: lipids, amino acids and carbohydrates. Indeed, we found that temperate decomposer metabolic efficiency of labile resources was positively correlated with a temperature-based timeline of decomposition (accumulated degree day (ADD)) (Fig. 2a–c , Extended Data Fig. 3c and Supplementary Tables 7 – 9 ). We found that two MAGs constituted a large portion of the increased amino acid and carbohydrate metabolism efficiencies at temperate locations: Oblitimonas alkaliphila ( Thiopseudomonas alkaliphila ) (Extended Data Fig. 3d ) and Corynebacterium intestinavium (Extended Data Fig. 3e ), respectively. This microbial response is probably an effect of heterogeneous selection (that is, selection driving the community to become different) driving the assemblage of the decomposer community, as heterogeneous selection increases relative to stochastic forces and homogeneous selection during decomposition (Fig. 2d,e , Extended Data Fig. 3f , and Supplementary Tables 10 and 11 ). We further hypothesized that microbe–microbe interactions probably contribute to selection 33 , which we investigated by calculating metabolic competitive and cooperative interaction potentials between our genome-scale metabolic models 34 , 35 . We found that metabolic competition potential initially increased at one temperate and the semi-arid location, suggesting an increase in microbes with similar resource needs (Extended Data Fig. 3g , and Supplementary Tables 12 and 13 ), which was not seen when communities were randomly subsampled within each site and decomposition stage (Extended Data Fig. 3h and Supplementary Table 12 ). Furthermore, we found that communities in temperate climates increased cross-feeding potential (that is, sharing of metabolic products) from early/active to advanced decomposition (Fig. 3a , and Supplementary Tables 12 and 13 ) and had a substantially higher number of cross-feeding exchanges during late decomposition than semi-arid climate communities (Fig. 3b and Supplementary Table 14 ), suggesting the increased potential for metabolic activity. The molecules predicted most for exchange by the models are common by-products of mammalian decomposition 36 , 37 , specifically of protein degradation 38 , and included hydrogen sulfide, acetaldehyde and ammonium, and 56% of the top 25 total exchanged molecules were amino acids. In contrast to temperate locations, semi-arid decomposer communities demonstrated a relatively diminished responsiveness to decomposition stage (Fig. 3c , Extended Data Fig. 4a , and Supplementary Tables 15 and 16 ) and did not significantly shift their metabolism efficiencies (Fig. 2a–c , Extended Data Fig. 3c and Supplementary Tables 7 – 9 ), probably due to a lack of water, which leads to higher metabolic costs 39 , decreased substrate supply 40 and growth 41 . Despite a less measurable microbial response at the semi-arid location, we did detect an increase in cross-feeding potential from early to active decomposition stages, suggesting that the semi-arid community has an increased ability to respond to decomposition nutrients (Fig. 3a , and Supplementary Tables 12 and 13 ) but probably at a smaller scale than temperate locations.

figure 2

a – c , Lipid ( a ), carbohydrate ( b ) and amino acid ( c ) metabolism efficiency as determined by the maximum ATP per C-mol of substrate that can be obtained from each community, plotted against the ADD the community was sampled. ARF n  = 212, STAFS n  = 198 and FIRS n  = 158 biologically independent samples. Data are presented as mean ± 95% confidence interval (CI). Significance was tested with linear mixed-effects models within each location including a random intercept for cadavers with two-tailed ANOVA and no multiple-comparison adjustments. ARF amino acids P  = 6.27 × 10 −23 , STAFS amino acids P  = 6.626 × 10 −10 , STAFS carbohydrate P  = 2.294 × 10 −07 and STAFS lipid P  = 3.591 × 10 −02 . d , Pairwise comparisons to obtain βNTI values focused on successional assembly trends by comparing initial soil at time of cadaver placement to early decomposition soil, then early to active and so on (PL, placement; EA, early; AC, active; AD, advanced) in the 16S rRNA amplicon dataset, showing that strong selection forces are pushing the community to differentiate. ARF n  = 232, STAFS n  = 202 and FIRS n  = 182 biologically independent samples. In boxplots, the lower and upper hinges of the box correspond to the first and third quartiles (the 25th and 75th percentiles); the upper and lower whiskers extend from the hinge to the largest and smallest values no further than 1.5× interquartile range (IQR), respectively; and the centre lines represent the median. The βNTI mean (diamond symbol) change between decomposition stage is represented by connected lines. Dashed lines represent when |βNTI| = 2. A |βNTI| value < 2 indicates stochastic forces (white background) drive community assembly. βNTI values <−2 and >2 indicate homogeneous (blue background) and heterogeneous (yellow background) selection drive assembly, respectively. The width of the violin plot represents the density of the data at different values. Significance was tested with Dunn Kruskal–Wallis H -test, with multiple-comparison P values adjusted using the Benjamini–Hochberg method. e , Representation of heterogeneous selection pressure relative abundance within the total pool of assembly processes increases over decomposition in the 16S rRNA amplicon dataset. Bars were calculated by dividing the number of community comparisons within with βNTI > +2 by the total number of comparisons. * P  < 0.05, ** P  < 0.01 and *** P  < 0.001.

Source Data

figure 3

a , Predicted cross-feeding interactions from MAGs are site-specific and significantly altered over decomposition. ARF n  = 201, STAFS n  = 188 and FIRS n  = 151 biologically independent samples. In boxplots, the lower and upper hinges correspond to the first and third quartiles (the 25th and 75th percentiles); the upper and lower whiskers extend from the hinge to the largest and smallest values no further than 1.5× IQR; the centre lines represent the median. Significance was tested with Dunn Kruskal–Wallis H -test, with multiple-comparison P values adjusted with the Benjamini–Hochberg method. ARF early-active P  = 1.95 × 10 −23 , early-advanced P  = 1.67 × 10 −23 ; STAFS early-active P  = 5.53 × 10 −39 , early-advanced P  = 3.65 × 10 −03 , active-advanced P  = 2.04 × 10 −24 ; FIRS early-active P  = 3.81 × 10 −15 . b , Increased cross-feeding reactions during semi-arid active decomposition and temperate advanced decomposition are summarized to show that compounds such as amino acids (red) are common among the top 25 potential cross-fed molecules from MAGs. c , Phylogenetic turnover in decomposition soil vs control soil shows that temperate climates react quickly to decomposition, while the more arid site does not quickly change (dashed lines represent breaks for early, active (grey shading) and advanced decomposition stages) using the 16S rRNA gene amplicon dataset. ARF n  = 414, STAFS n  = 316 and FIRS n  = 310 biologically independent samples. Data are presented as mean ± 95% CI. Significance was tested using linear mixed-effects models within each location, including a random intercept for cadavers with two-tailed ANOVA and no multiple-comparison adjustments. ARF and STAFS richness P  ≤ 2 × 10 −16 . d , Multi-omic (16S rRNA gene abundances, 18S rRNA gene abundances, MAG abundances, MAG gene abundances, MAG gene functional modules and metabolites) joint-RPCA shows that microbial community ecology is impacted by decomposition stage and geographical location. ** P  < 0.01 and *** P  < 0.001.

We further investigated potential effects of selective environmental conditions via multi-omic, joint robust principal components analysis (joint-RPCA) for dimensionality reduction (see Methods ) 42 , which all (climate, geographic location, season and decomposition stage) significantly shaped the microbial decomposer community ecology (Fig. 3d , Extended Data Fig. 4b–f and Supplementary Table 17 ). Climate (temperate vs semi-arid) along with location (ARF, STAFS, FIRS) significantly shaped the soil microbial community composition (Supplementary Tables 18 – 20 ) and its potential gene function (Supplementary Tables 21 – 22 ). Decomposition soils at temperate sites exhibited strong microbial community phylogenetic turnover (Fig. 3c and Supplementary Table 15 ) and a decrease in microbial richness during decomposition (Extended Data Fig. 4a and Supplementary Table 16 ), while less measurable effects were observed at the semi-arid location (Fig. 3c , Extended Data Fig. 4a , and Supplementary Tables 15 and 16 ). Season appeared to primarily influence soil chemistry as opposed to microbial community composition during decomposition (Supplementary Table 23 ), suggesting possible temperature-associated metabolism changes/limitations of microbial decomposer taxa. Taken together, these data suggest that while stochastic forces play a part in decomposer community assembly, deterministic forces, such as microbial interactions and environmental conditions, also play an important role.

Conserved interdomain soil microbial decomposer network

We discovered a universal network of microbes responding to the cadaver decomposition despite selection effects of climate, location and season on the assembly of the microbial decomposers within the soil. To focus on the universal decomposition effects across locations, we used the joint-RPCA principal component 2 (PC2) scores to generate the universal decomposition network due to their significant change over decomposition stage and reduced impact from location, season and climate (Fig. 4a,b , Extended Data Fig. 4b–f and Supplementary Table 24 ). Therefore, PC2 scores were used to calculate multi-omics of log ratios in late decomposition soil compared to initial and early decomposition soils (Fig. 4c , Extended Data Fig. 4g and Supplementary Table 25 ), which allowed us to identify key co-occurring bacterial and eukaryotic microbial decomposers, bacterial functional pathways and metabolites associated with late decomposition (Fig. 5a , Extended Data Fig. 5 and Supplementary Table 26 ). The organism O. alkaliphila , which is central to the network and a large contributor to the increased amino acid metabolism efficiency at temperate locations (Extended Data Fig. 3d ), may play a key role in terrestrial cadaver decomposition as a controller of labile resource utilization in temperate climates, but little is known about its ecology 43 , 44 , 45 . In addition, most microbial key network decomposers (Fig. 5a ; O. alkaliphila , Ignatzschineria , Wohlfahrtiimonas , Bacteroides , Vagococcus lutrae, Savagea , Acinetobacter rudis and Peptoniphilaceae ) represented unique phylogenetic diversity that was extremely rare or undetected in host-associated or soil microbial communities in American Gut Project (AGP) or Earth Microbiome Project (EMP) data sets (Fig. 5b , Extended Data Fig. 6 , and Supplementary Tables 27 and 28 ). Although the decomposers in the group Bacteroides have previously been assumed to derive from a human gut source 46 , 47 , we find that these are instead probably a specialist group of decomposers distinct from gut-associated Bacteroides (Fig. 5b , Extended Data Fig. 6 , and Supplementary Tables 27 and 28 ). The only strong evidence of key network bacterial decomposers emerging from soil and host-associated environments were in the genera Acinetobacter and Peptoniphilus (Fig. 5b , Extended Data Fig. 6 , and Supplementary Tables 27 and 28 ). We more comprehensively characterized microbial decomposer phylogenetic uniqueness with MAG data, which span previously undescribed bacterial orders, families, genera and species (Extended Data Fig. 3a ). Overall, we find that the soil microbial decomposer network is phylogenetically unique and in extremely low relative abundance in the environment until the cadaver nutrient pool becomes available.

figure 4

a , b , Principal component values show that ( a ) facility variation is primarily explained by principal component 3 (PC3) (that is, least overlap between group scores), while variation caused by ( b ) decomposition stage is explained by PC2. c , Change in log ratio of PC scores within omics datasets (metabolites, MAG abundances, 18S rRNA gene abundances and MAG gene functional modules) from initial soil through advanced decomposition stage soil highlights that decomposition stage progression corresponds to compositional shifts. All data types used the same n  = 374 biologically independent samples. Data are presented as mean ± 95% CI.

figure 5

a , Top 20% correlation values from features responsible for the universal late decomposition log-ratio signal in joint-RPCA PC2 visualized in a co-occurrence network. b , Phylogenetic tree representing ASVs associated with key decomposer nodes from the network placed along the top 50 most abundant ASVs taken from AGP gut, AGP skin, EMP soil and EMP host-associated datasets demonstrates that key decomposers are largely phylogenetically unique. Colour represents taxonomic order (full legend in Extended Data Fig. 6 ); the innermost ring represents decomposer placement, while outer rings represent AGP and EMP ASVs, for which bar height represents ASV rank abundance within each environment. A lack of bars indicates that the ASV was not present within the entire dataset. AGP and EMP ASVs were ranked according to the number of samples they were found in each environment. Decomposer ASVs are numbered clockwise (full taxonomy available in Supplementary Table 27 ).

We hypothesized that specialist decomposer network taxa probably interact to metabolize the nutrient pool, which we explored via estimated cross-feeding capabilities of co-occurring communities. Highlighting the importance of these key taxa, microbial decomposer network members accounted for almost half (42.8%) of predicted late decomposition nutrient exchanges (Figs. 3b and 5a , and Supplementary Table 29 ) with Gammaproteobacteria being prominent as both metabolite donors and receivers. For example, O. alkaliphila has the capability to cross-feed with Ignatzschineria , Acinetobacter , Savagea and Vagococcus lutrae , to which it donates amino acids known to be associated with mammalian decomposition such as aspartate, isoleucine, leucine, tryptophan and valine, along with the lipid metabolism intermediate, sn -Glycero-3-phosphoethanolamine 36 (Supplementary Table 30 ). As a receiver, O. alkaliphilia is predicted to receive essential ferrous ions (Fe 2+ ) from Acinetobacter , Savagea and Vagoccocus along with glutamate, proline and lysine from Ignatzschineria . Further, putrescine, a foul-smelling compound produced during decomposition by the decarboxylation of ornithine and arginine, and arginine/ornithine transport systems were universal functions within our network (Fig. 5a ). Cross-feeding analysis identified multiple potential ornithine and/or arginine exchangers, such as Ignatzschineria , Savagea , Wohlfahrtiimonas and O. alkaliphilia (Supplementary Table 31 ). Putrescine is an interdomain communication molecule probably playing an important role in assembling the universal microbial decomposer network by signalling scavengers such as blow flies 48 , which disperse decomposer microbes, as well as directly signalling other key microbial decomposers, such as fungi 49 , 50 , 51 .

Fungi play an essential role in the breakdown of organic matter; however, their processes and interdomain interactions during cadaver decomposition remain underexplored. Our network analysis identified multiple fungal members that are co-occurring with bacteria, belonging to the Ascomycota phylum (Fig. 5a )—a phylum known for its role in breaking down organic matter 6 , 44 , 52 , 53 . In particular, Yarrowia and Candida are known for their ability to utilize lipids, proteins and carbohydrates 44 , 53 , and both have one of their highest correlations with O. alkaliphila (Fig. 5a and Supplementary Table 25 ). The ability of Yarrowia and Candida to break down lipids and proteins during decomposition may serve as interdomain trophic interactions that allow O. alkaliphila to utilize these resources 44 . For example, Yarrowia and Candida genomes contain biosynthesis capabilities for arginine and ornithine that, if excreted, could be taken up by O. alkaliphilia . The complete genome of O. alkaliphilia (Genbank accession no. CP012358 ) contains the enzyme ornithine decarboxylase, which is responsible for converting ornithine to the key compound putrescine 43 .

Machine learning reveals a predictable microbial decomposer ecology

The assembly of a universal microbial decomposer network suggests the potential to build a robust forensics tool. We demonstrate that the PMI (calculated as ADD) can be accurately predicted directly from microbiome-normalized abundance patterns via random forest regression models (Fig. 6a ). High-resolution taxonomic community structure was the best predictor of PMI (Fig. 6b ), particularly normalized abundances of the 16S rRNA gene at the SILVA database level-7 taxonomic rank (L7) of the skin decomposer microbes (Fig. 6a–c ). Interestingly, 3 out of 4 of the skin-associated decomposer taxa that were most informative for the PMI model had similar normalized abundance trends over decompositions for bodies at all locations, suggesting that skin decomposers are more ubiquitous across climates than soil decomposers (Fig. 6d and Extended Data Fig. 7 ). We hypothesize that this is due to the human skin microbiome being more conserved between individuals than the soil microbiome is between geographic locations 54 . In fact, both skin and soil 16S rRNA-based models had the same top taxon as the most important predictor, Helcococcus seattlensis (Fig. 6d and Extended Data Fig. 7 ). H. seattlensis is a member of the order Tissierellales and family Peptoniphilaceae, both of which were key nodes within the universal decomposer network. In line with our hypothesis, H. seattlensis on the skin showed more-similar abundance trends for cadavers decomposing across both climate types, while H. seattlensis trends in the soil were primarily measurable at temperate locations (Fig. 6e and Extended Data Fig. 8 ). We found that normalized abundances of important soil taxa previously established to be in our universal decomposer network had strong climate signals, further suggesting a diminished responsiveness in semi-arid climates, such as temperate-climate responses with H. seattlensis , O. alkaliphila , Savagea sp., Peptoniphilus stercorisuis , Ignatzschineria sp. and Acinetobacter sp. (Extended Data Fig. 8c,d ). However, we found that the three most important PMI model soil taxa, Peptostreptococcus sp., Sporosarcina sp. and Clostridiales Family XI sp., had increased detection with decomposition in both semi-arid and temperate climates (Extended Data Fig. 8c,d ), suggesting that while strong climate-dependent fluctuations exist, there are microbial members that respond more ubiquitously to decomposition independent of climate. In addition, microbiome-based models and a TBS-based model had comparable average mean absolute errors (MAE) (Extended Data Fig. 9a ); however, 16S rRNA microbiome-based model predictions were on average closer to the actual observed values (that is, smaller average residual values), suggesting a higher accuracy (Fig. 6c and Extended Data Fig. 9a ). Lastly, we confirmed the model accuracy and reliability of PMI prediction using 16S rRNA amplicon data with an independent test set of samples that were collected at a different time from cadavers at locations and climates not represented in our model. We discovered that we could accurately predict the true PMIs of samples better than samples with randomized PMIs at all independent test set locations (Extended Data Fig. 9b,c and Supplementary Table 32 ), confirming the generalizability and robustness of our models in predicting new data from multiple geographies and climates with an accuracy useful for forensic death investigations.

figure 6

a , Cross-validation errors of multi-omic data sets. 16S and 18S rRNA gene data were collapsed to SILVA taxonomic level 7 (L7) and 12 (L12). Boxplots represent average prediction MAE in ADD of individual bodies during nested cross-validation of 36 body dataset. 16S rRNA soil face, soil hip, skin face and skin hip datasets contain n  = 600, 616, 588 and 500 biologically independent samples, respectively. 18S rRNA soil face, soil hip, skin face and skin hip datasets contain n  = 939, 944, 837 and 871 biologically independent samples, respectively. Paired 16S rRNA+18S rRNA soil face, soil hip, skin face and skin hip datasets contain n  = 440, 450, 428 and 356 biologically independent samples, respectively. MAG datasets contain n  = 569 biologically independent samples. Metabolite soil hip and skin hip datasets contain n  = 746 and 748 biologically independent samples, respectively. b , Mean absolute prediction errors are lowest when high-resolution taxonomic data are used for model training and prediction. Data represented contain the same biologically independent samples as in a . In boxplots in a and b , the lower and upper hinges of the boxplot correspond to the first and third quartiles (the 25th and 75th percentiles); the upper and lower whiskers extend from the hinge to the largest and smallest values no further than 1.5× IQR; the centre lines represent the median; the diamond symbol represents the mean. c , Linear regressions of predicted to true ADDs to assess model prediction accuracy show that all sampling locations significantly predict ADD. Data represented contain the same biologically independent samples as in a . Data are presented as mean ± 95% CI. Black dashed lines represent ratio of predicted to real ADD predictions at 1:1. The coloured solid lines represent the linear model calculated from the difference between the predicted and real ADD. d , The most important SILVA L7 taxa driving model accuracy from the best-performing model derived from 16S rRNA gene amplicon data sampled from the skin of the face. e , Comparison of abundance changes of the top important taxon, Helcococcus seattlensis , in skin reveals that low-abundance taxa provide predictive responses. Data plotted with loess regression and represent the same biologically independent samples as in a . Data are presented as mean ± 95% CI. Bact., bacterial; Avg., average; Marg., marginal.

We provide a genome-resolved, comprehensive view of microbial dynamics during cadaver decomposition and shed light on the assembly, interactions and metabolic shifts of a universal microbial decomposer network. We found that initial decomposer community assembly is driven by stochasticity, but deterministic forces increase over the course of decomposition, a finding in agreement with other conceptual models of microbial ecology 33 , 55 , 56 , 57 . These processes led to a decomposer network consisting of phylogenetically unique taxa emerging, regardless of season, location and climate, to synergistically break down organic matter. The ubiquitous decomposer and functional network revealed by our multi-omic data suggests that metabolism is coupled to taxonomy, at least to some extent, for cadaver decomposition ecology. However, the overall composition of microbial decomposer communities did vary between different climates and locations, indicating that some functional redundancy also probably exists. In a study of agricultural crop organic matter decomposition (straw and nutrient amendments), researchers similarly demonstrated that although functional redundancy probably plays a role, key microbial taxa emerge as important plant decomposers 15 , and a meta-analysis of microbial community structure–function relationships in plant litter decay found that community composition had a large effect on mass loss 58 . In terms of climatic controls over cadaver decomposition, temperate locations had a more measurable microbial response (for example, phylogenetic turnover, potential cross-feeding) in soils than the arid location in our study, and plant studies support the idea that climate is a strong determinant of decomposition rates and microbial activity 59 .

Despite the lesser response in the arid location, cadaver decomposer microbial ecologies were similar, suggesting that while climate may act as a strong control, microbial community composition follows similar assembly paths. We find evidence that key interdomain microbial decomposers of cadavers (that is, fungi and bacteria) emerge in diverse environments and probably utilize resource partitioning and cross-feeding to break down a nutrient pulse that is rich in lipids, proteins and carbohydrates. This process would be consistent with dogma within leaf litter ecology that fungal decomposers are typically specialized decomposers of complex substrates while bacteria serve as generalists that decompose a broader nutritional landscape 60 . Thus, we hypothesize that fungi (such as Yarrowia and Candida ) assist in the catabolism of complex, dead organic matter (such as lipids and proteins) into simpler compounds (such as fatty acids and amino acids), which are utilized by bacterial community members, (such as O. alkaliphila ) capable of efficiently metabolizing these by-products. This division of labour coupled with microbial interactions drives the assembly of the microbial decomposer community, in a process reminiscent of ecological dynamics observed in leaf litter decomposition 60 .

We suspect that key network microbial decomposers are probably not specific to decomposition of human cadavers and are, in part, maintained or seeded by insects. Key cadaver bacterial decomposers O. alkaliphila , Ignatzschineria , Wohlfahrtiimonas , Bacteroides , Vagococcus lutrae , Savagea , Acinetobacter rudis and Peptoniphilaceae have been detected in terrestrial decomposition studies of swine, cattle and mice (Supplementary Table 33 ) 16 , 24 , 25 , 26 , and a subset detected in aquatic decomposition 61 . Most key network bacterial decomposers, including the well-known blow fly-associated genera Ignatzschineria and Wohlfahrtiimonas 62 , were rare or not detected in a lab-based mouse decomposition study 6 in which insects were excluded (Supplementary Table 33 ). However, a different lab-based study that excluded blow flies but included carrion beetles 26 detected a subset of these key microbial decomposers, suggesting a role for microbe–insect interactions and dispersal by insects 26 , 48 , 63 . Further evidence implicating insects as important vectors is that all key network bacterial decomposers presented here have been detected on blow flies (Supplementary Table 28 ) 6 , 64 . Furthermore, Ascomycota fungal members, such as Yarrowia and Candida , have been previously detected in association with human, swine and mouse remains 6 , 26 , 44 , 53 . Yarrowia can be vertically transmitted from parent to offspring of carrion beetle 63 and may facilitate beetle consumption of carrion. Taken together, these findings suggest that key microbial decomposer taxa identified in this study of human cadavers are probably more generalizable carrion decomposers and are likely inoculated, at least partly, by insects.

We demonstrate the potential practical application of microbiome tools in forensic science by leveraging microbial community succession patterns and machine learning techniques for accurately predicting PMI. Importantly, the predictive models showcase their generalizability by accurately predicting the PMIs of independent test samples collected from various geographic locations and climates, including for test samples collected from a climate region not represented in the training set of the model. The best-performing model was able to accurately predict PMI within ~±3 calendar days during internal validation and on an independent test set (Supplementary Tables 34 and 35 ), which is a useful timeframe for forensic sciences, enabling investigators to establish crucial timelines and aiding in criminal investigations. Prediction errors are probably due to intrinsic (for example, BMI/total mass) 19 , 24 , 65 and/or extrinsic (for example, scavengers, precipitation) 19 , 26 factors not accounted for in the model, but should be a future area of research for model improvement. For example, total mass has been previously shown not to affect microbial decomposer composition in swine 24 ; however, ref. 19 found that Gammaproteobacteria relative abundance correlated with BMI of humans. Within our study, in which cadavers had highly variable initial total masses (Supplementary Table 1 ), Acinetobacter and Ignatzschineria (within Gammaproteobacteria) were important features in our PMI models, suggesting that it is probably robust to BMI (Extended Data Fig. 7 ). In addition, scavenging by invertebrates and vertebrates is another factor that can affect not only the decomposer microbial composition (for example, carrion beetles) 26 but also the microbes themselves which can shape the scavenger community via volatile organic compounds (for example, repel vertebrates but attract insects 48 , 66 ). A better understanding of which intrinsic and extrinsic factors directly affect microbes that are important features for predicting PMI will be an important next step.

Our improved understanding of the microbial ecology of decomposing human cadavers and its more general implications for the crucial and rarely studied carrion nutrient pool is critical for revising concepts of what should be included in carbon and nutrient budgets and the models used to forecast ecosystem function and change 11 . New insight on the role of carrion decomposition in fuelling carbon and nutrient cycling is needed for conceptual and numerical models of biogeochemical cycles and trophic processes 11 ; this study informs how the assembly and interactions among decomposer microbial communities facilitate the turnover and exchange of resources, and begins unlocking one of the remaining black boxes of ecosystem ecology. Finally, these findings may contribute to society by providing potential for a new forensic tool and for potentially modulating decomposition processes in both agricultural and human death industries via the key microbial decomposers identified here.

Site and donor selection

Outdoor experiments on 36 human cadavers were conducted at three willed-body donation facilities: Colorado Mesa University Forensic Investigation Research Station (FIRS), Sam Houston State University Southeast Texas Applied Forensic Science (STAFS) Facility and University of Tennessee Anthropology Research Facility (ARF). Before the start of the project, a meeting was held at STAFS to demonstrate, discuss and agree on sampling protocols. The Institutional Review Board and the Protection of Human Subjects Committee either determined that review was not required or granted exempt status for donors at each respective facility since the proposed research does not involve human donors as defined by federal regulations. Three deceased human donors were placed supine and unclothed on the soil surface in the spring, summer, fall and winter over the years 2016 and 2017 at each facility ( N  = 36). Bodies were placed on soil with no known previous human decomposition. Before placement, STAFS performed minimal removal of vegetation including raking of leaves and removal of shrubbery, and bodies placed at STAFS were placed in cages made of 1 cm × 1 cm wire fences and wooden frames to prevent vertebrate scavenging. The ARF and FIRS did not remove vegetation or place bodies under cages as standard protocol. Furthermore, bodies were placed no closer than 2.5 m between sternum midpoints. Collection date for each donor can be found in the sample metadata, in addition to cause of death if known, initial condition, autopsy status, weight before placement, age in years if known, estimated age if not known, sex, donor storage type, days donor was stored, time since death to cooling and placement head direction (Supplementary Table 1 ). Donor weight was taken at time of intake at ARF and FIRS but is a self-reported measure either by the donor before death or a family member at STAFS. During daily sampling, daily ambient average temperature and humidity, TBS 27 , scavenging status and insect status were recorded if available or applicable. Human bodies were fully exposed to all weather elements and invertebrate scavengers. Inclusion criteria for the remains were specified before the start of the experiment and required that the remains were in the fresh stage of decomposition and had not been frozen (and not extensively cooled) or autopsied before placement at the facility.

Decomposition metric calculations

The Köppen–Geiger climate classification system characterizes both the ARF and STAFS facilities as temperate without a dry season and hot summer (Cfa) and the FIRS facility as a cold semi-arid steppe (BSk) 23 . Average daily temperatures were collected from the National Centers for Environmental Information (NCEI) website ( https://www.ncei.noaa.gov/ ) and monthly total precipitation accumulation over the course of the study was collected from the Weather Underground website ( https://www.wunderground.com/ ) from local weather stations: Grand Junction Regional Airport Station, McGhee Tyson Airport Station and Easterwood Airport Station. Reference 27 TBS quantifies the degree to which decomposition has occurred in three main areas (head, trunk and limbs) 27 . The user assigned values to represent the progress of decomposition on the basis of visual assessment of the cadaver and added these values to generate a TBS at the time of sampling. A maximum score was assigned for each area when the cadaver has reached dry skeletal remains. ADD was estimated using the weather data provided by the NCEI. Degree day on the day of placement was not included, and a base temperature of 0 °C was used. ADD was calculated by adding together all average daily temperatures above 0 °C for all previous days of decomposition, as in ref. 27 , and subtracting the base temperature of 0 °C.

Sample collection and DNA extraction

We sampled the skin surface of the head and torso near the hip along with gravesoils (soils associated with decomposition) associated with each skin site over 21 d of decomposition. Control soil samples were taken of the same soil series and horizon that are not associated with body decomposition (known past or present) from areas within or just outside each facility. We collected swabs of 756 non-decomposition soil (controls), 756 gravesoil near the hip, 756 gravesoil near the face, 756 hip skin and 756 face skin samples ( N  = 3,780). All site samples (skin surface, gravesoil and control soil) were taken using sterile dual-tipped BD SWUBE applicator (REF 281130) swabs as described in ref. 18 , and immediately frozen after each sampling event and kept frozen at −20 °C. Samples were shipped to CU Boulder or Colorado State University overnight on dry ice and immediately stored at −20 °C upon arrival and until DNA extraction. Skin and soil DNA was extracted from a single tip of the dual-tipped swabs using the PowerSoil DNA isolation kit 96-htp (MoBio Laboratories), according to standard EMP protocols ( http://www.earthmicrobiome.org/ ).

Amplicon library preparation and sequencing

Bacterial and archaeal communities were characterized using 16S rRNA gene regions while eukaryotic communities were characterized using 18S rRNA gene regions as universal markers, for all successful skin and soil DNA extracts ( n  = 3,547). To survey bacteria and archaea, we used the primer set 515f (5′GTGYCAGCMGCCGCGGTAA) and 806rb (5′GGACTACNVGGGTWTCTAAT) that targets these domains near-universally 67 , 68 , with barcoded primers allowing for multiplexing, following EMP protocols 69 . To survey microbial eukaryotes, we sequenced a subregion of the 18S rRNA gene using the primers 1391f_illumina (5′GTACACACCGCCCGTC) and EukBr_illumina (5′TGATCCTTCTGCAGGTTCACCTAC) targeting the 3′ end of the 18S rRNA gene. 18S rRNA gene primers were adapted from ref. 70 and target a broad range of eukaryotic lineages. We have successfully generated and analysed data using these gene markers previously 6 , 18 . Primers included error-corrected Golay barcodes to allow for multiplexing while preventing misassignment. PCR amplicons were quantified using Picogreen Quant-iT (Invitrogen, Life Technologies) and pooled from each sample to equimolar ratio in a single tube before shipping to the UC San Diego genomics laboratory for sequencing. For both amplicon types, pools were purified using the UltraClean PCR clean-up kit (Qiagen). 16S rRNA pools were sequenced using a 300-cycle kit on the Illumina MiSeq sequencing platform and 18S rRNA gene pools were sequenced using a 300-cycle kit on the Illumina HiSeq 2500 sequencing platform (Illumina). Samples within a sample type (skin vs soil) were randomly assigned to a sequencing run to prevent potential batch effects. Blank DNA extraction and PCR negative controls were included throughout the entire process from DNA extraction to PCR amplification to monitor contamination ( n  = 592 negative controls).

Shotgun metagenomic library preparation and sequencing

Extracted DNA from a subset of hip-associated soil samples ( n  = 756), soil controls ( n  = 9), blank controls ( n  = 102) and no-template PCR controls ( n  = 15) were chosen to undergo shallow shotgun sequencing to provide in-depth investigation of microbial dynamics within decomposition soil (Supplementary Table 4 ). Our standard protocol followed that of ref. 71 and was optimized for an input quantity of 1 ng DNA per reaction. Before library preparation, input DNA was transferred to 384-well plates and quantified using a PicoGreen fluorescence assay (ThermoFisher). Input DNA was then normalized to 1 ng in a volume of 3.5 μl of molecular-grade water using an Echo 550 acoustic liquid-handling robot (Labcyte). Enzyme mixes for fragmentation, end repair and A-tailing, ligation and PCR were prepared and added at 1:8 scale volume using a Mosquito HV micropipetting robot (TTP Labtech). Fragmentation was performed at 37 °C for 20 min, followed by end repair and A-tailing at 65 °C for 30 min. Sequencing adapters and barcode indices were added in two steps, following the iTru adapter protocol 72 . Universal adapter ‘stub’ adapter molecules and ligase mix were first added to the end-repaired DNA using the Mosquito HV robot and ligation performed at 20 °C for 1 h. Unligated adapters and adapter dimers were then removed using AMPure XP magnetic beads and a BlueCat purification robot (BlueCat Bio). A 7.5 μl magnetic bead solution was added to the total adapter-ligated sample volume, washed twice with 70% ethanol and then resuspended in 7 μl molecular-grade water.

Next, individual i7 and i5 indices were added to the adapter-ligated samples using the Echo 550 robot. Because this liquid handler individually addresses wells and we used the full set of 384 unique error-correcting i7 and i5 indices, we generated each plate of 384 libraries without repeating any barcodes, eliminating the problem of sequence misassignment due to barcode swapping (61, 62). To ensure that libraries generated on different plates could be pooled if necessary and to safeguard against the possibility of contamination due to sample carryover between runs, we also iterated the assignment of i7 to i5 indices per run, such that each unique i7:i5 index combination is only repeated once every 147,456 libraries 72 . A volume of 4.5 μl of eluted bead-washed ligated samples was added to 5.5 μl of PCR master mix and PCR-amplified for 15 cycles. The amplified and indexed libraries were then purified again using AMPure XP magnetic beads and the BlueCat robot, resuspended in 10 μl of water and 9 μl of final purified library transferred to a 384-well plate using the Mosquito HTS liquid-handling robot for library quantitation, sequencing and storage. All samples were then normalized on the basis of a PicoGreen fluorescence assay for sequencing.

Samples were originally sequenced on an Illumina HiSeq 4000; however, due to some sequencing failures, samples were resequenced on the Illumina NovaSeq 6000 platform. To ensure that we obtained the best sequencing results possible, we assessed both sequencing runs and added the best-performing sample of the two runs to the final analysis (that is, if sample X provided more reads from the HiSeq run than the NovaSeq run, we added the HiSeq data from that sample to the final analysis and vice versa). Samples were visually assessed to ensure that no batch effects from the two sequencing runs were present in beta diversity analysis. A list of which samples were pulled from the HiSeq vs NovaSeq runs can be found in the sample metadata under the column ‘best_MetaG_run’, with their corresponding read count under ‘MetaG_read_count’ (Supplementary Table 1 ). In total, 762 samples were sequenced, with 25 coming from the HiSeq run and 737 samples coming from the Novaseq run. Raw metagenomic data had adapters removed and were quality filtered using Atropos (v.1.1.24) 73 with cut-offs of q  = 15 and minimum length of 100 nt. All human sequence data were filtered out by aligning against the Genome Reference Consortium Human Build 38 patch release 7 (GRCh37/hg19) reference database released in 21 March 2016 (ncbi.nlm.nih.gov/assembly/GCF_000001405.13/) and removing all data that matched the reference from the sequence data. Alignment was performed with bowtie2 (v.2.2.3) 74 using the --very-sensitive parameter, and the resulting SAM files were converted to FASTQ format with samtools (v.1.3.1) 75 and bedtools (v.2.26.0) 76 . Metagenomic samples were removed from the analysis if they had <500 k reads. Final metagenomic sample numbers were 569 hip-adjacent soil, 5 soil controls, 102 blank controls and 15 no-template controls.

Metabolite extraction and LC–MS/MS data generation

To investigate the metabolite pools associated with decomposition skin and gravesoils, we performed metabolite extraction on the second tip of the dual-tipped swabs collected from the skin and soil associated with the hip sampling location to ensure all datasets are paired. Skin and soil swab samples were extracted using a solution of 80% methanol. Briefly (with all steps performed on ice), swabs were placed into a pre-labelled 96-well DeepWell plate where A1–D1 were used for a solvent blank and E1–H1 were used for blank clean swabs with extraction solvent added. Swab shafts were cut aseptically and 500 μl of solvent (80% methanol with 0.5 μM sulfamethazine) was added. The DeepWell plate was covered and vortexed for 2 min, followed by 15 min in a water sonication bath. Next, samples were incubated at 4 °C for 2 h, followed by a 12 h incubation at −20 °C. Swab tips were then removed from the solvent and samples were lyophilised. Untargeted metabolomics LC–MS/MS data were generated from each sample. Two types of dataset were generated from each sample: MS1 data for global and statistical analysis and MS/MS data for molecular annotation. Molecular annotation was performed through the GNPS platform https://gnps.ucsd.edu/ . Molecules were annotated with the GNPS reference libraries 77 using accurate parent mass and MS/MS fragmentation pattern according to level 2 or 3 of annotation defined by the 2007 metabolomics standards initiative 78 . If needed and if the authentic chemical standard was available, MS/MS data were collected from the chemical standard and compared to MS/MS spectra of the molecule annotated from the sample (level 1 of annotation).

Amplicon data processing

After data generation, amplicon sequence data were analysed in the Metcalf lab at Colorado State University using the QIIME2 analysis platform v.2020.2 and v.2020.8 (ref. 79 ). In total, 4,139 samples were sequenced, including 592 DNA extraction blank negative and no-template PCR controls. Sequencing resulted in a total of 89,288,561 16S rRNA partial gene reads and 1,543,472,127 18S rRNA partial gene reads. Sequences were quality filtered and demultiplexed using the pre-assigned Golay barcodes. Reads were 150 bp in length. 18S rRNA gene sequences had primers (5′GTAGGTGAACCTGCAGAAGGATCA) removed using cutadapt to ensure that the variable length of the 18S region was processed without primer contamination. Sequences were then classified into amplicon sequence variants (ASVs) in groups of samples that were included on the same sequencing run so the programme could accurately apply the potential error rates from the machine using the Deblur denoising method (v.2020.8.0) 80 . Feature tables and representative sequences obtained from denoising each sequencing run were then merged to create a complete dataset for each amplicon method. Taxonomic identifiers were assigned to the ASVs using the QIIME feature-classifier classify-sklearn method 81 . For the 16S rRNA gene data, these assignments were made using the SILVA 132 99% classifier for the 515fb/806rb gene sequences. ASVs that were assigned to chloroplast or mitochondria (non-microbial sequences) were filtered out of the dataset before continuing analysis. For 18S rRNA data, the RESCRIPt (v.2022.8.0) plugin was used to extract the full 12-level taxonomy from sequences matching the primers from the SILVA 138 99% database, to dereplicate the extracted sequences and to train a classifier to assign labels to ASVs in the feature table 82 . This taxonomy was used to filter out any ASVs that were assigned to Archaea, Streptophyta, Bacteria, Archaeplastida, Arthropoda, Chordata, Mollusca and Mammalia, as well as those that were unassigned, resulting in 5,535 ASVs at a total frequency of 772,483,701. DNA extraction negative and no-template PCR control samples were analysed to determine that contamination within the samples was minimal. Most control samples were low abundance and below the threshold used for rarefaction. The few controls that were above the rarefaction threshold clustered distantly and separately from true samples on principal coordinate analysis (PCoA) and had low alpha diversities, hence samples above the rarefaction depth were considered minimally contaminated and acceptable for analyses. Subsequently, DNA extraction negative and no-template PCR control samples were removed from the dataset and future analyses.

Microbial diversity metrics were generated from both amplicon types using the QIIME2 phylogenetic diversity plugin. The phylogenetic trees were constructed for each amplicon type individually using the fragment-insertion SEPP method 83 against the SILVA 128 99% reference tree. Alpha diversity metrics were calculated using the number of observed features as ASV richness and Faith’s phylogenetic diversity formulas. Statistical comparisons were made using the pairwise Kruskal–Wallis H -test with a Benjamini–Hochberg multiple-testing correction at an alpha level of 0.05 (ref. 84 ). To evaluate beta diversity, the generalized UniFrac method weighted at 0.5 was used to calculate dissimilarity 85 . Statistical comparisons were made using permutational analysis of variance (PERMANOVA) with a multiple-testing correction and an alpha level of 0.05 (ref. 86 ). Taxonomy and alpha diversity visualizations were created using ggplot2 and the viridis package in R 87 , 88 . Beta diversity principal coordinates plots were constructed using the Emperor (v.2022.8.0) plugin in QIIME2 (ref. 89 ). Linear mixed-effects models were used to evaluate the contribution of covariates to a single dependent variable and to test whether community alpha diversity metrics (for example, ASV richness) and beta diversity distances (for example, UniFrac distances) were impacted by decomposition time (that is, ADD) and sampling location (that is, decomposition soil adjacent to the hip and control soil). The response variables were statistically assessed over ADD with sampling site (that is, decomposition soil vs control soil) as an independent variable (fixed effect) and a random intercept for individual bodies to account for repeated measures using the formula: diversity metric ≈ ADD × sampling site + (1|body ID).

Detection of key decomposers in other decomposition studies

16S rRNA gene amplicon sequence data files from refs. 6 , 24 , 25 , 64 , 69 , 90 , 91 were obtained from QIITA 92 under study IDs 10141–10143, 1609, 13114, 10317, 13301 and 11204, respectively. Data obtained from QIITA 92 had been previously demultiplexed and denoised using Deblur 80 and are available on the QIITA 92 study page. Data from ref. 16 were obtained from the NCBI Sequence Read Archive under BioProject PRJNA525153 . Forward reads were imported into QIIME2 (v.2023.5) 79 , demultiplexed and denoised using Deblur (v.1.1.1) 80 . Data from ref. 26 were obtained from the Max Planck Society Edmond repository ( https://edmond.mpdl.mpg.de/dataset.xhtml?persistentId=doi:10.17617/3.UV4FBN ). Forward reads were imported into QIIME2 (v.2023.5) 79 and demultiplexed. Primers (5′ GTGCCAGCMGCCGCGGTAA) were removed using cutadapt (v.4.4) 93 and the data were denoised using Deblur (v.1.1.1) 80 . ASVs from all studies were assigned taxonomy using a naïve Bayes taxonomy classifier trained on the V4 (515f/806r) region of SILVA 138 99% operational taxonomic units (OTUs). Data tables were imported into Jupyter notebooks (Jupyter Lab v.4.0.5) 94 for further analysis (Python v.3.8.16). A search for the 35 universal PMI decomposer ASVs was conducted within each dataset. This search matched exact ASVs in our dataset to other datasets but did not match similar ASVs that may be classified as the same taxon. The relative abundance of each decomposer ASV was first averaged across all samples within a specific metadata category. The average relative abundances were then summed across each decomposer genus. Prevalence tables were constructed by summing the number of samples across a specific metadata category in which each universal decomposer ASV was present. The presence of Wohlfahrtiimonas was found in the ref. 26 dataset; however, these ASVs were not exact sequence matches to our universal Wohlfahrtiimonas decomposers and probably represent insect-associated strains (Supplementary Table 33 ; Wohlfahrtiimonadaceae column). We searched within the remaining studies for the presence of other ASVs assigned to the Wohlfahrtiimonas genus or ASVs that were assigned to the Wohlfahrtiimonadaceae family but these were unidentified at the genus level. Average relative abundances were calculated as described above.

Community assembly mechanism determination

To investigate the ecological processes driving bacterial assembly, we quantitatively inferred community assembly mechanisms by phylogenetic bin-based null model analysis of 16S rRNA gene amplicon data as described in refs. 95 , 96 . Longitudinal turnover in phylogenetic composition within the decomposition soil between successional stages was quantified using the beta nearest taxon index (βNTI), where a |βNTI| value <+2 indicates that stochastic forces drive community assembly and a value >+2 indicates less than or greater than expected phylogenetic turnover by random chance (deterministic forces). βNTI values <−2 correspond to homogeneous selection and values >+2 correspond to heterogeneous selection. Homogeneous selection refers to communities that are more similar to each other than expected by random chance, while heterogeneous selection refers to communities that are less similar to each other than expected by random chance. Deterministic forces include selection factors such as environmental filtering and biological interactions, while stochastic forces include random factors such as dispersal, birth–death events and immigration.

MAGs generation and classification

To maximize assembly, metagenomes were co-assembled within sites using MEGAHIT (v.1.2.9) 97 with the following flags: –k-min 41 (see Supplementary Tables 4 – 6 for a list of samples used to generate metagenomic data, co-assembly statistics, GTDB taxonomic classification and TPM-normalized count abundance of MAGs within each sample). Assembled scaffolds >2,500 kb were binned into MAGs using MetaBAT2 (v.2.12.1) 98 with default parameters. MAG completion and contamination were assessed using checkM (v.1.1.2) 99 . MAGs were conservatively kept in the local MAG database if they were >50% complete and <10% contaminated. MAGs were dereplicated at 99% identity using dRep (v.2.6.2) 100 . MAG taxonomy was assigned using GTDB-tk (v.2.0.0, r207) 101 . Novel taxonomies were determined as the first un-named taxonomic level in the GTDB classification string (see Supplementary Table 5 for MAG quality and taxonomy information). MAGs and co-assemblies were annotated using DRAM (v.1.0.0) 102 (Supplementary Table 5 ; https://doi.org/10.5281/zenodo.7843104 ). From 575 metagenomes, we recovered 1,130 MAGs, of which 276 were medium or high quality, and dereplicated these at 99% identity into 257 MAGs. This MAG set encompassed novel bacterial orders ( n  = 3), families ( n  = 9), genera ( n  = 28) and species ( n  = 158), providing genomic blueprints for microbial decomposers dominated by Gammaproteobacteria and Actinobacteriota (Supplementary Table 5 ).

MAG and gene abundance mapping

To determine the abundance of the MAGs in each sample, we mapped reads from each sample to the dereplicated MAG set using bowtie2 (v.2.3.5) 74 with the following flags: -D 10 -R 2 -N 1 -L 22 -i S,0,2.50. Output sam files were converted to sorted BAM files using samtools (v.1.9) 75 . BAM files were filtered for reads mapping at 95% identity using the reformat.sh script with flag idfilter=0.95 from BBMap (v.38.90) ( https://sourceforge.net/projects/bbmap/ ). Filtered BAM files were input to CoverM (v0.3.2) ( https://github.com/wwood/CoverM ) in genome mode to output transcripts per million (TPM). To determine the abundance of genes across samples, we clustered the gene nucleotide sequences from the annotated assemblies output by DRAM using MMseqs2 (release 13) easy-linclust (v4e23d5f1d13a435c7b6c9406137ed68ce297e0fc) 103 with the following flags: –min-seq-id 0.95–alignment-mode 3–max-seqs 100000. We then mapped reads to the cluster representative using bowtie2 (ref. 74 ) and filtered them to 95% identity as described above for the MAGs. To determine gene abundance, filtered bams were input to coverM in contig mode to output TPM. Bacterial MAG feature tables were imported into QIIME2 (v.2020.8) 79 . Bacterial features that were not present for a total of 50 times and were found in less than six samples were removed from the dataset to reduce noise. Bacterial feature tables were collapsed at the phylum, class, order, family, genus and species GTDB taxonomic levels. Community diversity was compared between the MAG and 16S rRNA ASV feature tables to ensure that both data types demonstrate the same biological signal. Each table was filtered to contain samples with paired 16S rRNA and metagenomic data (that is, samples with both metagenomic and 16S rRNA data). Bray–Curtis dissimilarity matrices were calculated for the TPM-normalized MAG abundance table and rarified 16S rRNA ASV table. Procrustes/PROTEST 104 , 105 and Mantel tests were performed between the PCoA ordinations and distance matrices, respectively 106 . Results showed that the datasets were not significantly different from each other and confirmed their shared biological signal (Extended Data Fig. 10 ).

Metabolic interaction simulations

Higher-order (20 microbial members) co-occurrence patterns were calculated from the MAG relative frequency tables of each decomposition stage (that is, early, active, advanced) for each facility using HiOrCo (v.1.0.0) (cut-off 0.001) ( https://github.com/cdanielmachado/HiOrCo ). HiOrCo provides 100 iterations of co-occurring MAG communities to improve simulation accuracy. No significantly co-occurring MAGs were detected at the FIRS facility during advanced decomposition; therefore, we continued the analyses using only early and active decomposition stages at FIRS. CarveMe (v.1.5.1) 107 was used to construct genome-scale metabolic models (GEMs) from each MAG using default parameters ( https://github.com/cdanielmachado/carveme ). GEMs from each co-occurring MAG community were input as a microbial community into SMETANA (v1.0.0) ( https://github.com/cdanielmachado/smetana ) to compute several metrics that describe the potential for metabolic cooperative and competitive interactions between community members as described in refs. 34 , 35 . Metrics include metabolic interaction potential (MIP), metabolic resource overlap (MRO), species coupling score (SCS), metabolite uptake score (MUS), metabolite production score (MPS) and SMETANA score. MIP calculates how many metabolites the species can share to decrease their dependency on external resources. MRO is a method of assessing metabolic competition by measuring the overlap between the minimal nutritional requirements of all member species on the basis of their genomes. SCS is a community size-dependent measurement of the dependency of one species in the presence of the others to survive. MUS measures how frequently a species needs to uptake a metabolite to survive. MPS is a binary measurement of the ability of a species to produce a metabolite. The individual SMETANA score is a combination of the SCS, MUS and MPS scores and gives a measure of certainty of a cross-feeding interaction (for example, species A receives metabolite X from species B). Simulations were created on the basis of a minimal medium, calculated using molecular weights, that supports the growth of both organisms, with the inorganic compounds hydrogen, water and phosphate excluded from analysis. A random null model analysis was performed to ensure that changes in co-occurring MAGs within each site and decomposition are driving interaction potential changes. For each site and decomposition stage, 100 20-member communities were generated by random selection without replacement using random.sample(). Simulations to calculate MIP and MRO were performed as above. A detailed investigation into the potential molecules being cross-fed was performed on the late stages of decomposition for each facility: temperate-climate advanced decomposition and semi-arid active decomposition stages.

Metabolic efficiency simulations

Metabolic models and the Constraint Based Reconstruction and Analysis (COBRA) toolbox (v.3.0) 108 were used to simulate differences in metabolic capabilities between samples that are spatiotemporally different. A general base growth medium, M 0 , containing a list of carbohydrates, amino acids, lipids and other vitamins and minerals adapted from a previous study 109 was used. From this base medium, carbohydrate-rich, M 1 , amino acid-rich, M 2 , and lipid-rich, M 3 , media were defined. The carbohydrate-rich medium includes all compounds in the base medium but allows for higher uptake of carbohydrates than proteins and lipids, and vice versa. The COBRA toolbox 108 in MATLAB was used to optimize overall ATP production from M 1 , M 2 and M 3 for each individual MAG in an aerobic condition. This assumption was made because the topsoil conditions in which decomposition happens are relatively aerobic. The calculated maximum ATP yields can be interpreted as the maximum capability of each MAG in extracting ATP from the growth media. Finally, the weighted average of total ATP production from the GEMs in a sample was calculated by multiplying the relative abundance of each MAG by the maximum total ATP production and summing over all of the GEMs in a sample 110 .

Molecular networking and spectral library search

A molecular network was created using the Feature-Based Molecular Networking (FBMN) workflow (v.28.2) 111 on GNPS ( https://gnps.ucsd.edu ; ref. 77 ). The mass spectrometry data were first processed with MZMINE2 (v.2.53) 112 and the results were exported to GNPS for FBMN analysis. The precursor ion mass tolerance was set to 0.05 Da and the MS/MS fragment ion tolerance to 0.05 Da. A molecular network was then created where edges were filtered to have a cosine score above 0.7 and >5 matched peaks. Furthermore, edges between two nodes were kept in the network if and only if each of the nodes appeared in each other’s respective top 10 most similar nodes. Finally, the maximum size of a molecular family was set to 100, and the lowest-scoring edges were removed from molecular families until the molecular family size was below this threshold. The spectra in the network were then searched against GNPS spectral libraries 77 , 111 . All matches kept between network spectra and library spectra were required to have a score above 0.7 and at least 6 matched peaks.

Metabolite formula and class prediction

Spectra were downloaded from GNPS and imported to SIRIUS (v.4.4) 113 containing ZODIAC 114 for database-independent molecular formula annotation under default parameters. Formula annotations were kept if the ZODIAC score was at least 0.95 and at least 90% of the MS/MS spectrum intensity was explained by SIRIUS as described by the less-restrictive filtering from ref. 114 . A final list of formula identifications was created by merging ZODIAC identifications with library hits from GNPS (Supplementary Table 36 ). In the cases where a metabolite had both a ZODIAC predicted formula and an assigned library hit, the library hit assignment took precedence. The final formula list contained 604 formula assignments. Organic compound composition was examined in van Krevelen diagrams and assigned to major biochemical classes on the basis of the molar H:C and O:C ratios 115 . Since classification based on molecular ratio does not guarantee that the compound is part of a specific biochemical class, compounds were labelled as chemically similar by adding ‘-like’ to their assigned class (for example, protein-like). Furthermore, compound formulas were used to calculate the nominal oxidation state of carbon on the basis of the molecular abundances of C, H, N, O, P and S as described in ref. 116 (Supplementary Tables 37 and 38 ).

Metabolite feature table processing

The metabolite feature table downloaded from GNPS was normalized using sum normalization, then scaled with pareto scaling 117 and imported in QIIME2 (v.2022.2) 79 . This table contains all library hits, metabolites with predicted formulas and unannotated metabolites. PCoA clustering with Bray–Curtis and Jaccard distances confirmed clustering of processing controls separate from soil and skin samples. Five soil samples were removed for clustering with processing controls. Processing controls were removed from the dataset; then metabolites absent from a minimum of 30 samples were removed to reduce noise. Bray–Curtis and Jaccard beta diversity group comparisons were performed between soil and skin samples using PERMANOVA (perm. = 999). The metabolite feature table was filtered to contain metabolites with chemical formulas based on GNPS library hits and/or predicted chemical formulas from ZODIAC. Differential abundance analyses were performed on these tables from the cadaver-associated soil and skin to test metabolite log-ratio change over decomposition stage using initial, day 0 samples as the reference frame, utilizing the Analysis of Composition of Microbiomes with Bias Correction (ANCOM-BC) 118 QIIME2 (v.2022.2) plugin.

The complete methodology including mathematical formulas for joint-RPCA can be found in Supplementary Text . Briefly, before joint factorization, we first split the dataset into training train and testing sample sets from the total set of shared samples across all input data matrices. The datasets included in this analysis were 16S rRNA gene abundances, 18S rRNA gene abundances, MAG abundances, MAG gene abundances, MAG gene functional modules and metabolites from the hip-adjacent decomposition soil. Each matrix was then transformed through the robust-centred-log-ratio transformation (robust-clr) to centre the data around zero and approximate a normal distribution 42 , 119 . Unlike the traditional clr transformation, the robust-clr handles the sparsity often found in biological data without requiring imputation. The robust-clr transformation was applied to the training and test set matrices independently. The joint factorization used here was built on the OptSpace matrix completion algorithm, which is a singular value decomposition optimized on a local manifold 42 , 119 . A shared matrix was estimated across the shared samples of all input matrices. For each matrix, the observed values were only computed on the non-zero entries and then averaged, such that the minimized shared estimated matrices were optimized across all matrices. The minimization was performed across iterations by gradient descent. To ensure that the rotation of the estimated matrices was consistent, the estimated shared matrix and the matrix of shared eigenvalues across all input matrices were recalculated at each iteration. To prevent overfitting of the joint-factorization, cross-validation of the reconstruction was performed. In this case, all the previously described minimization was performed on only the training set data. The test set data were then projected into the same space using the training set data estimated matrices and the reconstruction of the test data was calculated. Through this, it can be ensured that the minimization error of the training data estimations also minimizes that of the test set data, which is not incorporated into these estimates on each iteration. After the training data estimates were finalized, the test set samples were again projected into the final output to prevent these samples from being lost. The correlations of all features across all input matrices were calculated from the final estimated matrices. Finally, here we treated the joint-RPCA with only one input matrix as the original RPCA 119 but with the additional benefit of the addition of cross-validation for comparison across other methods.

Multi-omics ecological network visualization

The datasets included in this analysis were 18S rRNA gene abundances, MAG abundances, MAG gene functional modules and metabolites from the hip-adjacent decomposition soil. log ratios were generated using the joint-RPCA PC2 scores, chosen on the basis of the sample ordination, to rank each omics feature on the basis of association with either initial non-decomposition and early decomposition soil or late decomposition (that is, active and advanced) soil time periods. The log ratios are the log ratio of the sum of the top N -features raw-counts/table-values over the sum of the bottom N ranked features raw-counts/table-values, based on the PC2 loadings produced from the ordinal analysis since these were observed to change the most by decomposition stage. To prevent sample drop out in the log ratio due to sparsity, as described in refs. 120 , 121 , between 2 and 1,500 numerator and denominator features for each omic were summed such that at least 90% of the sample were retained: metagenomics (MAGs) N -features = 30 (99.2%), 18S N -features = 1,499 (90.1%), metagenomics (gene modules) N -features = 26 (100%) and metabolomics N -features = 238 (100%). The joint-RPCA correlation matrix was subset down to the total initial day zero, early, active or advanced decomposition-associated features used in the log ratios to generate the network visualizations. Only the top 20% of correlations between selected nodes were retained to reduce noise in generating the network visualization.

Phylogenetic tree generation

Redbiom (v.0.3.9) 122 was used to search for all publicly available AGP 90 and EMP 69 studies for samples containing at least 100 counts of a key decomposer. The AGP samples were further filtered to only include gut and skin environments and the EMP samples were limited to only include soil and host environment. Next, the top 50 most abundant ASVs were taken from each environment along with the key decomposers and placed on a phylogenetic tree using Greengenes2 (release 2022.10) 123 . The ASVs were then ranked according to the number of samples they were found in and visualized using EMPress (v.1.2.0) 124 .

Random forest regression modelling

Processed features tables from each ‘omic data type were used for random forest regression modelling with nested cross-validation (CV) to test ADD prediction power. Data were subset so that models were trained and tested for each sampling location separately (for example, soil adjacent to the hip, soil adjacent to the face, skin of the hip and skin of the face). Data were pre-processed for models using calour (v.2018.5.1) ( http://biocore.github.io/calour/index.html ) and models were trained/tested using scikit-learn (v.0.24.2) 125 . Features with an abundance of zero in the dataset after filtering were removed. The facilities at which sampling was performed were included as features in the model to determine whether geographical location is important for modelling. Samples from individual bodies were grouped together to prevent samples from a body being split between train and test sets to help prevent overfitting. Nested CV was performed to thoroughly test the accuracy and generalizability of the models. Hyperparameters tested for optimization were: max_depth = [None, 4], max_features = [‘auto’, 0.2] and bootstrap = [True, False]. Nested CV was made of an outer CV loop and an inner CV loop. The outer loop was created by a LeaveOneGroupOut split wherein samples from one of the 36 bodies were set aside for model validation after the inner CV loop completes. The remaining 35 bodies were used for RandomForestRegressor (n_estimators = 500) model training with the inner CV loop. The inner CV loop performed a LeaveOneGroupOut split as well so that 34 bodies were used to train a model, which was tested on the samples from the one withheld body in the inner CV loop. This inner CV was repeated until all 35 bodies within the inner loop were used as a test body once to determine which hyperparameters were best for prediction. The best-performing inner CV model was then used to predict the samples from the 36th body that was withheld at the outer CV loop, which now acts as a validation test set. Model accuracy was determined by calculating the MAE of the predicted ADD relative to the actual ADD of all the validation body samples. The prediction of the samples from the 36th body, which was completely withheld from the training of the model, allowed us to reduce overfitting and gain an estimate of the model accuracy. The entire nested CV process was repeated until each body was used as the outer CV loop validation body one time (that is, 36 iterations). The resulting 36 mean absolute errors of each body were used for determining model accuracy, generalizability and which data type performed the best. To ensure that we were using the complete dataset to determine the important taxa driving the models, the best-performing hyperparameters (bootstrap=False, max_depth=None, max_features=0.2) were used to train a RandomForestRegressor (n_estimators = 1,000) model to extract the important features. Important features were ranked by their relative importance on a scale from 0–1, where the sum of all importances equals 1. A random forest model using TBS from each sampling day as training data for ADD prediction was trained and tested using the same methodology to compare microbiome-based models to a more traditional method of assessing decomposition progression.

Lastly, we confirmed the accuracy and reliability of postmortem interval prediction with an independent test set of samples collected from bodies not represented in our models. The independent test set was collected from hip-adjacent soil and skin of the hip locations across three facilities (ARF, Forensic Anthropology Research Facility in San Marcos, Texas (FARF) and Research on Experimental and Social Thanatology in Quebec, Canada (REST)) (Supplementary Table 39 ). The independent test set was made up of temporal samples taken from each facility. ARF and REST samples consisted of three bodies with three timepoints taken from each body at each facility. At each timepoint, a soil sample was swabbed within the purge and outside the purge, and a skin sample was swabbed from the hip. One ARF body (B3.D4) did not have purge during the first timepoint; therefore, this sample was not collected. FARF provided samples from four bodies. Two bodies (2021.04 and 2021.45) had the same sampling procedure as ARF and REST, while the other two bodies (2021.39 and 2021.44) did not have purge during the first sampling timepoint; hence samples were not collected. Samples were collected, shipped, stored, DNA extracted and 16S rRNA V4 sequenced using the previously described methods. After data generation, amplicon sequence data were analysed in the Metcalf lab using QIIME2 (v.2020.8) 79 . Sequences were quality filtered and demultiplexed using the pre-assigned Golay barcodes. Reads were 150 bp in length. Sequences were then classified into ASVs using the deblur denoising method 80 . Taxonomic identifiers were assigned to the ASVs using the QIIME feature-classifier classify-sklearn method 81 using the SILVA 132 99% classifier for the 515fb/806rb gene sequences. ASVs that were assigned to chloroplast or mitochondria (non-microbial sequences) were filtered out of the dataset before continuing analysis. Data were rarified to 5,000 reads per sample and collapsed to the SILVA database 7-rank taxonomic level (L7). Feature tables were split into soil and skin data; then the validation data table was matched to the original dataset so that sampling location and features were the same (that is, using only taxa found in hip-adjacent soil in both datasets). A random forest regressor model (n_estimators=1000, max_depth=None, bootstrap=False, max_features=0.2) was built and fitted to predict the validation samples’ true ADD measurement. Randomly assigned ADDs were used as a null model.

Statistics and reproducibility

From March 2016 to December 2017, 36 human cadavers were sampled daily starting on the day of placement through 21 d of decomposition. The study encompasses three geographically distinct anthropological research facilities, and 3 cadavers were placed at each facility for each of the four seasons. Swab samples were collected from soil directly adjacent to the hip, face and a control, non-decomposition location. Swab samples were also collected from skin located on the hip and the face. No statistical method was used to predetermine sample size. The samples were randomized during processing. The investigators were not blinded to allocation during experiments and outcome assessment. Samples were excluded if not enough DNA was extracted, sequenced or if sequence quality was poor. Negative controls were included during DNA/metabolite extraction, amplification and library preparation. Linear statistical modelling was performed with linear mixed-effects models to a single dependent variable, and response variables were statistically assessed over ADD with a random intercept for individual bodies to account for repeated measures. Group comparisons were performed using Dunn Kruskal–Wallis H -test with multiple-comparison P values adjusted using the Benjamini–Hochberg method, two-tailed analysis of variance (ANOVA) with no multiple-comparison adjustments, or PERMANOVA with a multiple-testing correction. Differential abundance analyses were performed using ANCOM-BC 118 with initial, day 0 samples as the reference frame. Procrustes/PROTEST 104 , 105 and Mantel tests were performed between PCoA ordinations and distance matrices, respectively 106 .

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

Raw amplicon and metagenomic sequencing data and sample metadata are available on the QIITA open-source microbiome study management platform under study 14989 and ENA accession PRJEB62460 ( ERP147550 ). Dereplicated MAGs and DRAM output can be found publicly on Zenodo ( https://doi.org/10.5281/zenodo.7843104 ; https://zenodo.org/record/7938240 ) and NCBI BioProject PRJNA973116 . The mass spectrometry data were deposited on the MassIVE public repository (accession numbers: MSV000084322 for skin samples and MSV000084463 for soil samples). The molecular networking job can be publicly accessed at https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=1c73926f2eb5409985cc2e136062db2f . The GNPS database was accessed through https://gnps.ucsd.edu/ . The GreenGenes2 database can be found at https://ftp.microbio.me/greengenes_release/ . SILVA databases can be found at https://www.arb-silva.de/documentation/release-1381/ . The Earth Microbiome Project data and American Gut Project data can be found on EBI under accessions ERP125879 and ERP012803 , respectively. 16S rRNA gene amplicon sequence data files from refs. 6 , 24 , 25 , 64 , 69 , 90 , 91 were obtained from QIITA 92 under study IDs 10141–10143 (ref. 6 ), 1609 (refs. 24 , 25 ), 13114 (ref. 69 ), 10317 (ref. 90 ), 13301 (ref. 64 ) and 11204 (ref. 91 ). Data from ref. 16 were obtained from the NCBI Sequence Read Archive under BioProject PRJNA525153 . Data from ref. 26 were obtained from the Max Planck Society Edmond repository ( https://edmond.mpdl.mpg.de/dataset.xhtml?persistentId=doi:10.17617/3.UV4FBN ). The GTDB data can be accessed at https://data.gtdb.ecogenomic.org/releases/ . Source data are provided with this paper.

Code availability

Analysis code, intermediate files and metadata are publicly available on Github ( https://github.com/Metcalf-Lab/2023-Universal-microbial-decomposer-network ). The complete mathematical algorithms for Joint-RPCA can be found in Supplementary Text .

Swift, M. J., Heal, O. W. & Anderson, J. M. Decomposition in Terrestrial Ecosystems (Blackwell Scientific, 1979).

Carter, D. O., Yellowlees, D. & Tibbett, M. Cadaver decomposition in terrestrial ecosystems. Naturwissenschaften 94 , 12–24 (2007).

Article   CAS   PubMed   Google Scholar  

Wagg, C., Schlaeppi, K., Banerjee, S., Kuramae, E. E. & van der Heijden, M. G. A. Fungal–bacterial diversity and microbiome complexity predict ecosystem functioning. Nat. Commun. 10 , 4841 (2019).

Article   PubMed   PubMed Central   Google Scholar  

Schroeter, S. A. et al. Microbial community functioning during plant litter decomposition. Sci. Rep. 12 , 7451 (2022).

Article   CAS   PubMed   PubMed Central   Google Scholar  

Strickland, M. S., Lauber, C., Fierer, N. & Bradford, M. A. Testing the functional significance of microbial community composition. Ecology 90 , 441–451 (2009).

Article   PubMed   Google Scholar  

Metcalf, J. L. et al. Microbial community assembly and metabolic function during mammalian corpse decomposition. Science 351 , 158–162 (2016).

Pechal, J. L. et al. The potential use of bacterial community succession in forensics as described by high throughput metagenomic sequencing. Int. J. Leg. Med. 128 , 193–205 (2014).

Article   Google Scholar  

Bar-On, Y. M., Phillips, R. & Milo, R. The biomass distribution on Earth. Proc. Natl Acad. Sci. USA 115 , 6506–6511 (2018).

Parmenter, R. R. & MacMahon, J. A. Carrion decomposition and nutrient cycling in a semiarid shrub–steppe ecosystem. Ecol. Monogr. 79 , 637–661 (2009).

Barton, P. S., Cunningham, S. A., Lindenmayer, D. B. & Manning, A. D. The role of carrion in maintaining biodiversity and ecological processes in terrestrial ecosystems. Oecologia 171 , 761–772 (2013).

Barton, P. S. et al. Towards quantifying carrion biomass in ecosystems. Trends Ecol. Evol. 34 , 950–961 (2019).

Putman, R. J. Flow of energy and organic matter from a carcase during decomposition: decomposition of small mammal carrion in temperate systems 2. Oikos 31 , 58–68 (1978).

Article   CAS   Google Scholar  

DeVault, T. L., Brisbin, I. L. Jr & Rhodes, O. E. Jr Factors influencing the acquisition of rodent carrion by vertebrate scavengers and decomposers. Can. J. Zool. 82 , 502–509 (2004).

Aneja, M. K. et al. Microbial colonization of beech and spruce litter—influence of decomposition site and plant litter species on the diversity of microbial community. Microb. Ecol. 52 , 127–135 (2006).

Banerjee, S. et al. Network analysis reveals functional redundancy and keystone taxa amongst bacterial and fungal communities during organic matter decomposition in an arable soil. Soil Biol. Biochem. 97 , 188–198 (2016).

Dangerfield, C. R., Frehner, E. H., Buechley, E. R., Şekercioğlu, Ç. H. & Brazelton, W. J. Succession of bacterial communities on carrion is independent of vertebrate scavengers. PeerJ 8 , e9307 (2020).

Johnson, H. R. et al. A machine learning approach for using the postmortem skin microbiome to estimate the postmortem interval. PLoS ONE 11 , e0167370 (2016).

Metcalf, J. L. et al. A microbial clock provides an accurate estimate of the postmortem interval in a mouse model system. eLife 2 , e01104 (2013).

Singh, B. et al. Temporal and spatial impact of human cadaver decomposition on soil bacterial and arthropod community structure and function. Front. Microbiol. 8 , 2616 (2017).

Hong, E. S., Bang, S. H., Kim, Y.-H. & Min, J. Treatment of livestock carcasses in soil using Corynebacterium glutamicum and lysosomal application to livestock burial. Environ. Health Toxicol. 33 , e2018009 (2018).

Fey, S. B. et al. Recent shifts in the occurrence, cause, and magnitude of animal mass mortality events. Proc. Natl Acad. Sci. USA 112 , 1083–1088 (2015).

Metcalf, J. L. Estimating the postmortem interval using microbes: knowledge gaps and a path to technology adoption. Forensic Sci. Int. Genet. 38 , 211–218 (2019).

Beck, H. E. et al. Present and future Köppen-Geiger climate classification maps at 1-km resolution. Sci. Data 5 , 180214 (2018).

Weiss, S., Carter, D. O., Metcalf, J. L. & Knight, R. Carcass mass has little influence on the structure of gravesoil microbial communities. Int. J. Leg. Med. 130 , 253–263 (2015).

Carter, D. O., Metcalf, J. L., Bibat, A. & Knight, R. Seasonal variation of postmortem microbial communities. Forensic Sci. Med. Pathol. 11 , 202–207 (2015).

Shukla, S. P. et al. Microbiome-assisted carrion preservation aids larval development in a burying beetle. Proc. Natl Acad. Sci. USA 115 , 11274–11279 (2018).

Megyesi, M. S., Nawrocki, S. P. & Haskell, N. H. Using accumulated degree-days to estimate the postmortem interval from decomposed human remains. J. Forensic Sci. 50 , 618–626 (2005).

Connor, M., Baigent, C. & Hansen, E. S. Measuring desiccation using qualitative changes: a step toward determining regional decomposition sequences. J. Forensic Sci. 64 , 1004–1011 (2019).

Towne, E. G. Prairie vegetation and soil nutrient responses to ungulate carcasses. Oecologia 122 , 232–239 (2000).

Vass, A. A., Bass, W. M., Wolt, J. D., Foss, J. E. & Ammons, J. T. Time since death determinations of human cadavers using soil solution. J. Forensic Sci. 37 , 1236–1253 (1992).

Coe, M. The decomposition of elephant carcases in the Tsavo (East) National Park, Kenya. J. Arid Environ. 1 , 71–86 (1978).

Cotrufo, M. F., Wallenstein, M. D., Boot, C. M., Denef, K. & Paul, E. The Microbial Efficiency-Matrix Stabilization (MEMS) framework integrates plant litter decomposition with soil organic matter stabilization: do labile plant inputs form stable soil organic matter? Glob. Change Biol. 19 , 988–995 (2013).

Gralka, M., Szabo, R., Stocker, R. & Cordero, O. X. Trophic interactions and the drivers of microbial community assembly. Curr. Biol. 30 , R1176–R1188 (2020).

Zelezniak, A. et al. Metabolic dependencies drive species co-occurrence in diverse microbial communities. Proc. Natl Acad. Sci. USA 112 , 6449–6454 (2015).

Machado, D. et al. Polarization of microbial communities between competitive and cooperative metabolism. Nat. Ecol. Evol. 5 , 195–203 (2021).

DeBruyn, J. M. et al. Comparative decomposition of humans and pigs: soil biogeochemistry, microbial activity and metabolomic profiles. Front. Microbiol. 11 , 608856 (2020).

Keenan, S. W., Schaeffer, S. M., Jin, V. L. & DeBruyn, J. M. Mortality hotspots: nitrogen cycling in forest soils during vertebrate decomposition. Soil Biol. Biochem. 121 , 165–176 (2018).

Carbonero, F., Benefiel, A. C., Alizadeh-Ghamsari, A. H. & Gaskins, H. R. Microbial pathways in colonic sulfur metabolism and links with health and disease. Front. Physiol. 3 , 448 (2012).

Parr, W. R. G. J. Water Potential Relations in Soil Microbiology (Soil Science Society of America, 1981).

Stark, J. M. & Firestone, M. K. Mechanisms for soil moisture effects on activity of nitrifying bacteria. Appl. Environ. Microbiol. 61 , 218–221 (1995).

Manzoni, S., Taylor, P., Richter, A., Porporato, A. & Ågren, G. I. Environmental and stoichiometric controls on microbial carbon-use efficiency in soils. New Phytol. 196 , 79–91 (2012).

Martino, C. et al. A novel sparse compositional technique reveals microbial perturbations. mSystems 4 , e00016–e00019 (2019).

Drobish, A. M. et al. Oblitimonas alkaliphila gen. nov., sp. nov., in the family Pseudomonadaceae, recovered from a historical collection of previously unidentified clinical strains. Int. J. Syst. Evol. Microbiol. 66 , 3063–3070 (2016).

Ashe, E. C., Comeau, A. M., Zejdlik, K. & O’Connell, S. P. Characterization of bacterial community dynamics of the human mouth throughout decomposition via metagenomic, metatranscriptomic, and culturing techniques. Front. Microbiol. 12 , 689493 (2021).

Dong, N. et al. Prevalence, transmission, and molecular epidemiology of tet(X)-positive bacteria among humans, animals, and environmental niches in China: an epidemiological, and genomic-based study. Sci. Total Environ. 818 , 151767 (2022).

Cobaugh, K. L., Schaeffer, S. M. & DeBruyn, J. M. Functional and structural succession of soil microbial communities below decomposing human cadavers. PLoS ONE 10 , e0130201 (2015).

Keenan, S. W. et al. Spatial impacts of a multi-individual grave on microbial and microfaunal communities and soil biogeochemistry. PLoS ONE 13 , e0208845 (2018).

Tomberlin, J. K. et al. Interkingdom responses of flies to bacteria mediated by fly physiology and bacterial quorum sensing. Anim. Behav. 84 , 1449–1456 (2012).

Shi, Z. et al. Putrescine is an intraspecies and interkingdom cell–cell communication signal modulating the virulence of Dickeya zeae . Front. Microbiol. 10 , 1950 (2019).

Valdés-Santiago, L. & Ruiz-Herrera, J. Stress and polyamine metabolism in fungi. Front. Chem. 1 , 42 (2013).

PubMed   Google Scholar  

Tofalo, R., Cocchi, S. & Suzzi, G. Polyamines and gut microbiota. Front. Nutr. 6 , 16 (2019).

Challacombe, J. F. et al. Genomes and secretomes of Ascomycota fungi reveal diverse functions in plant biomass decomposition and pathogenesis. BMC Genomics 20 , 976 (2019).

Fu, X. et al. Fungal succession during mammalian cadaver decomposition and potential forensic implications. Sci. Rep. 9 , 12907 (2019).

Fierer, N. et al. Cross-biome metagenomic analyses of soil microbial communities and their functional attributes. Proc. Natl Acad. Sci. USA 109 , 21390–21395 (2012).

Dini-Andreote, F., Stegen, J. C., van Elsas, J. D. & Salles, J. F. Disentangling mechanisms that mediate the balance between stochastic and deterministic processes in microbial succession. Proc. Natl Acad. Sci. USA 112 , E1326–E1332 (2015).

Zhou, J. & Ning, D. Stochastic community assembly: does it matter in microbial ecology? Microbiol. Mol. Biol. Rev . https://doi.org/10.1128/mmbr.00002-17 (2017).

Zhou, J. et al. Stochasticity, succession, and environmental perturbations in a fluidic ecosystem. Proc. Natl Acad. Sci. USA 111 , E836–E845 (2014).

Waring, B., Gee, A., Liang, G. & Adkins, S. A quantitative analysis of microbial community structure–function relationships in plant litter decay. iScience 25 , 104523 (2022).

Aerts, R. Climate, leaf litter chemistry and leaf litter decomposition in terrestrial ecosystems: a triangular relationship. Oikos 79 , 439–449 (1997).

Purahong, W. et al. Life in leaf litter: novel insights into community dynamics of bacteria and fungi during litter decomposition. Mol. Ecol. 25 , 4059–4074 (2016).

Pechal, J. L., Crippen, T. L., Cammack, J. A., Tomberlin, J. K. & Benbow, M. E. Microbial communities of salmon resource subsidies and associated necrophagous consumers during decomposition: potential of cross-ecosystem microbial dispersal. Food Webs 19 , e00114 (2019).

Hyde, E. R., Haarmann, D. P., Petrosino, J. F., Lynne, A. M. & Bucheli, S. R. Initial insights into bacterial succession during human decomposition. Int. J. Leg. Med. 129 , 661–671 (2015).

Vogel, H. et al. The digestive and defensive basis of carcass utilization by the burying beetle and its microbiota. Nat. Commun. 8 , 15186 (2017).

Deel, H. L. et al. The microbiome of fly organs and fly–human microbial transfer during decomposition. Forensic Sci. Int. 340 , 111425 (2022).

Mason, A. R. et al. Body mass index (BMI) impacts soil chemical and microbial response to human decomposition. mSphere 7 , e0032522 (2022).

Burkepile, D. E. et al. Chemically mediated competition between microbes and animals: microbes as consumers in food webs. Ecology 87 , 2821–2831 (2006).

Caporaso, J. G. et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 6 , 1621–1624 (2012).

Walters, W. et al. Improved bacterial 16S rRNA gene (V4 and V4-5) and fungal internal transcribed spacer marker gene primers for microbial community surveys. mSystems https://doi.org/10.1128/msystems.00009-15 (2016).

Thompson, L. R. et al. A communal catalogue reveals Earth’s multiscale microbial diversity. Nature 551 , 457–463 (2017).

Amaral-Zettler, L. A., McCliment, E. A., Ducklow, H. W. & Huse, S. M. A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA genes. PLoS ONE 4 , e6372 (2009).

Sanders, J. G. et al. Optimizing sequencing protocols for leaderboard metagenomics by combining long and short reads. Genome Biol. 20 , 226 (2019).

Glenn, T. C. et al. Adapterama I: universal stubs and primers for 384 unique dual-indexed or 147,456 combinatorially-indexed Illumina libraries (iTru & iNext). PeerJ 7 , e7755 (2019).

Didion, J. P., Martin, M. & Collins, F. S. Atropos: specific, sensitive, and speedy trimming of sequencing reads. PeerJ 5 , e3720 (2017).

Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9 , 357–359 (2012).

Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25 , 2078–2079 (2009).

Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26 , 841–842 (2010).

Wang, M. et al. Sharing and community curation of mass spectrometry data with Global Natural Products Social Molecular Networking. Nat. Biotechnol. 34 , 828–837 (2016).

Sumner, L. W. et al. Proposed minimum reporting standards for chemical analysis Chemical Analysis Working Group (CAWG) Metabolomics Standards Initiative (MSI). Metabolomics 3 , 211–221 (2007).

Bolyen, E. et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 37 , 852–857 (2019).

Amir, A. et al. Deblur rapidly resolves single-nucleotide community sequence patterns. mSystems 2 , e00191-16 (2017).

Bokulich, N. A. et al. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome 6 , 90 (2018).

Robeson, M. S. 2nd et al. RESCRIPt: reproducible sequence taxonomy reference database management. PLoS Comput. Biol. 17 , e1009581 (2021).

Janssen, S. et al. Phylogenetic placement of exact amplicon sequences improves associations with clinical information. mSystems 3 , e00021-18 (2018).

Kruskal, W. H. & Wallis, W. A. Use of ranks in one-criterion variance analysis. J. Am. Stat. Assoc. 47 , 583–621 (1952).

Chen, J. et al. Associating microbiome composition with environmental covariates using generalized UniFrac distances. Bioinformatics 28 , 2106–2113 (2012).

Anderson, M. J. A new method for non‐parametric multivariate analysis of variance. Austral Ecol. 26 , 32–46 (2001).

Google Scholar  

Wickham, H. Ggplot2. Wiley Interdiscip. Rev. Comput. Stat. 3 , 180–185 (2011).

R Core Team. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2020).

Vázquez-Baeza, Y., Pirrung, M., Gonzalez, A. & Knight, R. EMPeror: a tool for visualizing high-throughput microbial community data. Gigascience 2 , 16 (2013).

McDonald, D. et al. American Gut: an open platform for citizen science microbiome research. mSystems 3 , e00031-18 (2018).

Kodama, W. A. et al. Trace evidence potential in postmortem skin microbiomes: from death scene to morgue. J. Forensic Sci. 64 , 791–798 (2019).

Gonzalez, A. et al. Qiita: rapid, web-enabled microbiome meta-analysis. Nat. Methods 15 , 796–798 (2018).

Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 17 , 10–12 (2011).

Kluyver, T. et al. in Positioning and Power in Academic Publishing: Players, Agents and Agendas (eds Loizides, F. & Scmidt, B.) 87–90 (IOS Press, 2016).

Stegen, J. C. et al. Quantifying community assembly processes and identifying features that impose them. ISME J. 7 , 2069–2079 (2013).

Stegen, J. C., Lin, X., Fredrickson, J. K. & Konopka, A. E. Estimating and mapping ecological processes influencing microbial community assembly. Front. Microbiol. 6 , 370 (2015).

Li, D., Liu, C.-M., Luo, R., Sadakane, K. & Lam, T.-W. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31 , 1674–1676 (2015).

Kang, D. D. et al. MetaBAT 2: an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies. PeerJ 7 , e7359 (2019).

Parks, D. H., Imelfort, M., Skennerton, C. T., Hugenholtz, P. & Tyson, G. W. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 25 , 1043–1055 (2015).

Olm, M. R., Brown, C. T., Brooks, B. & Banfield, J. F. dRep: a tool for fast and accurate genomic comparisons that enables improved genome recovery from metagenomes through de-replication. ISME J. 11 , 2864–2868 (2017).

Chaumeil, P.-A., Mussig, A. J., Hugenholtz, P. & Parks, D. H. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics 36 , 1925–1927 (2019).

Shaffer, M. et al. DRAM for distilling microbial metabolism to automate the curation of microbiome function. Nucleic Acids Res. 48 , 8883–8900 (2020).

Steinegger, M. & Söding, J. MMseqs2 enables sensitive protein sequence searching for the analysis of massive data sets. Nat. Biotechnol. 35 , 1026–1028 (2017).

Gower, J. C. Generalized procrustes analysis. Psychometrika 40 , 33–51 (1975).

Jackson, D. A. PROTEST: a PROcrustean Randomization TEST of community environment concordance. Écoscience 2 , 297–303 (1995).

Peres-Neto, P. R. & Jackson, D. A. How well do multivariate data sets match? The advantages of a Procrustean superimposition approach over the Mantel test. Oecologia 129 , 169–178 (2001).

Machado, D., Andrejev, S., Tramontano, M. & Patil, K. R. Fast automated reconstruction of genome-scale metabolic models for microbial species and communities. Nucleic Acids Res. 46 , 7542–7553 (2018).

Heirendt, L. et al. Creation and analysis of biochemical constraint-based models using the COBRA Toolbox v.3.0. Nat. Protoc. 14 , 639–702 (2019).

Bittinger, K. et al. Bacterial colonization reprograms the neonatal gut metabolome. Nat. Microbiol. 5 , 838–847 (2020).

Chan, S. H. J., Simons, M. N. & Maranas, C. D. SteadyCom: predicting microbial abundances while ensuring community stability. PLoS Comput. Biol. 13 , e1005539 (2017).

Nothias, L.-F. et al. Feature-based molecular networking in the GNPS analysis environment. Nat. Methods 17 , 905–908 (2020).

Pluskal, T., Castillo, S., Villar-Briones, A. & Oresic, M. MZmine 2: modular framework for processing, visualizing, and analyzing mass spectrometry-based molecular profile data. BMC Bioinformatics 11 , 395 (2010).

Dührkop, K. et al. SIRIUS 4: a rapid tool for turning tandem mass spectra into metabolite structure information. Nat. Methods 16 , 299–302 (2019).

Ludwig, M. et al. Database-independent molecular formula annotation using Gibbs sampling through ZODIAC. Nat. Mach. Intell. 2 , 629–641 (2020).

Kim, S., Kramer, R. W. & Hatcher, P. G. Graphical method for analysis of ultrahigh-resolution broadband mass spectra of natural organic matter, the van Krevelen diagram. Anal. Chem. 75 , 5336–5344 (2003).

Boye, K. et al. Thermodynamically controlled preservation of organic carbon in floodplains. Nat. Geosci. 10 , 415–419 (2017).

van den Berg, R. A., Hoefsloot, H. C. J., Westerhuis, J. A., Smilde, A. K. & van der Werf, M. J. Centering, scaling, and transformations: improving the biological information content of metabolomics data. BMC Genomics 7 , 142 (2006).

Lin, H. & Peddada, S. D. Analysis of compositions of microbiomes with bias correction. Nat. Commun. 11 , 3514 (2020).

Keshavan, R. H., Montanari, A. & Oh, S. Matrix completion from a few entries. IEEE Trans. Inf. Theory 56 , 2980–2998 (2010).

Fedarko, M. W. et al. Visualizing ’omic feature rankings and log-ratios using Qurro. NAR Genom. Bioinform. 2 , lqaa023 (2020).

Martino, C. et al. Context-aware dimensionality reduction deconvolutes gut microbial community dynamics. Nat. Biotechnol. 39 , 165–168 (2021).

McDonald, D. et al. redbiom: a rapid sample discovery and feature characterization system. mSystems 4 , e00215–e00219 (2019).

McDonald, D. et al. Greengenes2 unifies microbial data in a single reference tree. Nat. Biotechnol. https://doi.org/10.1038/s41587-023-01845-1 (2023).

Cantrell, K. et al. EMPress enables tree-guided, interactive, and exploratory analyses of multi-omic data sets. mSystems 6 , e01216–e01220 (2021).

Pedregosa, F., Varoquaux, G. & Gramfort, A. Scikit-learn: machine learning in Python. J. Mach. Learn. Res. 12 , 2825–2830 (2011).

Download references

Acknowledgements

Foremost, we thank the willed-body donors for their contribution to science; A. Esterle, K. Otto, H. Archer, C. Carter, R. Reibold, L. Burcham, J. Prenni and the CSU Writes programme for technical and resource contributions; A. Buro, V. Rodriguez, M. Sarles, A. Hartman and A. Uva at SHSU for field contributions. Opinions or points of view expressed here represent a consensus of the authors and do not necessarily represent the official position or policies of the US Department of Justice. Any use of trade, firm or product names is for descriptive purposes only and does not imply endorsement by the US Government. Funding was provided by the National Institutes of Justice (2016-DN-BX-0194, J.L.M.; 2015-DN-BX-K016, J.L.M.; GRF STEM 2018-R2-CX-0017, A.D.B.; GRF STEM 2018-R2-CX-0018, H.L.D.), the Canadian Institute for Advanced Research Global Scholar Program (J.L.M.), National Science Foundation Early Career Award (1912915, K. C. Wrighton) and National Institutes of Health T32 Training Award (T32GM132057, V.N.).

Author information

Authors and affiliations.

Department of Animal Sciences, Colorado State University, Fort Collins, CO, USA

Zachary M. Burcham, Aeriel D. Belk, Alexandra Emmons, Victoria Nieciecki & Jessica L. Metcalf

Department of Microbiology, University of Tennessee, Knoxville, TN, USA

Zachary M. Burcham

Department of Animal Sciences, Auburn University, Auburn, AL, USA

Aeriel D. Belk

Department of Soil and Crop Sciences, Colorado State University, Fort Collins, CO, USA

Bridget B. McGivern, Michael Shaffer & Kelly C. Wrighton

Collaborative Mass Spectrometry Innovation Center, Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, San Diego, CA, USA

Amina Bouslimani, Morgan Panitchpakdi, Kelly C. Weldon & Pieter C. Dorrestein

Department of Chemical and Biological Engineering, Colorado State University, Fort Collins, CO, USA

Parsa Ghadermazi & Siu Hung Joshua Chan

Department of Pediatrics, University of California San Diego, La Jolla, California, USA

Cameron Martino, Qiyun Zhu, Greg C. Humphry, Gail Ackermann, Daniel McDonald & Rob Knight

Center for Studies in Physics and Biology, Rockefeller University, New York, NY, USA

Liat Shenhav

Institute for Systems Genetics, New York Grossman School of Medicine, New York University, New York, NY, USA

Department of Computer Science, New York University, New York, NY, USA

Department of Biostatistics and Bioinformatics, Duke University, Durham, NC, USA

Anru R. Zhang & Pixu Shi

Department of Computer Science, Duke University, Durham, NC, USA

Anru R. Zhang

Graduate Program in Cell and Molecular Biology, Colorado State University, Fort Collins, CO, USA

Heather L. Deel, Victoria Nieciecki & Jessica L. Metcalf

School of Food Science and Technology, Nanchang University, Nanchang, Jiangxi, China

Zhenjiang Zech Xu

School of Life Sciences, Arizona State University, Tempe, AZ, USA

Center for Fundamental and Applied Microbiomics, Arizona State University, Tempe, AZ, USA

Department of Computer Science and Engineering, University of California San Diego, La Jolla, CA, USA

Kalen Cantrell & Rob Knight

Department of Computer Science, Colorado State University, Fort Collins, CO, USA

Asa Ben-Hur

U.S. Geological Survey, Southwest Biological Science Center, Moab, UT, USA

Sasha C. Reed

Forensic Investigation Research Station, Colorado Mesa University, Grand Junction, CO, USA

Melissa Connor

Forensic Anthropology Center, Department of Anthropology, University of Tennessee, Knoxville, TN, USA

Derek Boyd, Jake Smith, Jenna M. S. Watson, Giovanna Vidoli & Dawnie Steadman

Department of Social, Cultural, and Justice Studies, University of Tennessee at Chattanooga, Chattanooga, TN, USA

Mid-America College of Funeral Service, Jeffersonville, IN, USA

Department of Biological Sciences, Sam Houston State University, Huntsville, TX, USA

Aaron M. Lynne & Sibyl Bucheli

Laboratory of Forensic Taphonomy, Forensic Sciences Unit, School of Natural Sciences and Mathematics, Chaminade University of Honolulu, Honolulu, HI, USA

David O. Carter

Center for Microbiome Innovation, University of California San Diego, La Jolla, CA, USA

Department of Bioengineering, University of California San Diego, La Jolla, CA, USA

Humans and the Microbiome Program, Canadian Institute for Advanced Research, Toronto, Ontario, Canada

Jessica L. Metcalf

You can also search for this author in PubMed   Google Scholar

Contributions

Z.M.B., D.O.C., R.K., K. C. Wrighton and J.L.M. conceptualized the project. Z.M.B., A.D.B., B.B.M., A.B., C.M., H.L.D., M.P., K. C. Weldon, G.C.H., G.A., M.C., D.B., J.S., G.V., D.S., A.M.L., S.B., P.C.D., K. C. Wrighton, D.O.C., R.K. and J.L.M. contributed to data curation. Z.M.B., A.D.B., B.B.M., P.G., C.M., L.S., A.R.Z., P.S., A.E., H.L.D., V.N., M.S., K.C. and D.M. conducted formal analysis. K. C. Wrighton, D.O.C., R.K. and J.L.M. acquired funding. A.B., M.P., K. C. Weldon, M.C., D.B., J.S., J.M.S.W., G.V., D.S., A.M.L. and S.B. contributed to project investigation. Z.M.B., A.D.B., B.B.M., A.B., P.G., C.M., L.S., A.R.Z., P.S., Z.Z.X., V.N., Q.Z., M.S., M.P., K. C. Weldon, K.C., A.B.-H., S.H.J.C., M.C., D.B., J.S., G.V., D.S., A.M.L., S.B., P.C.D., K. C. Wrighton, D.O.C., R.K. and J.L.M. developed the methodology. Z.M.B., M.C., G.V., D.S., A.M.L., S.B., P.C.D., K. C. Wrighton, D.O.C., R.K. and J.L.M. administered the project. S.H.J.C., M.C., G.V., D.S., A.M.L., S.B., P.C.D., K. C. Wrighton, D.O.C. and R.K. provided resources. Z.M.B., A.D.B., B.B.M., P.G., C.M., L.S., A.R.Z., P.S., Z.Z.X., M.S., K.C., A.B.-H., D.M. and P.C.D. developed software. S.H.J.C., M.C., G.V., D.S., A.M.L., S.B., P.C.D., K. C. Wrighton, D.O.C. and R.K. supervised the project. Z.M.B., A.D.B., B.B.M., P.G., C.M., M.C., G.V., D.S., A.M.L., S.B., P.C.D., K. C. Wrighton, R.K. and J.L.M. conducted data validation. Z.M.B., A.D.B., B.B.M., P.G., C.M., A.E. and S.C.R. worked on visualization. Z.M.B., A.D.B., A.E., B.B.M., S.C.R., D.O.C. and J.L.M. wrote the original draft. Z.M.B., A.D.B., B.B.M., P.G., C.M., H.L.D., S.C.R., D.M., M.C., S.B., P.C.D., K. C. Wrighton, D.O.C., R.K. and J.L.M. reviewed and edited the manuscript.

Corresponding author

Correspondence to Jessica L. Metcalf .

Ethics declarations

Competing interests.

P.C.D. consulted in 2023 for DSM animal health, is a consultant and holds equity in Sirenas and Cybele Microbiome, and is founder and scientific advisor and has equity in Ometa Labs LLC, Arome and Enveda (with approval by UC San Diego). R.K. is affiliated with Gencirq (stock and SAB member), DayTwo (consultant and SAB member), Cybele (stock and consultant), Biomesense (stock, consultant, SAB member), Micronoma (stock, SAB member, co-founder) and Biota (stock, co-founder). The other authors declare no competing interests.

Peer review

Peer review information.

Nature Microbiology thanks Anna Heintz-Buschart, Michael Strickland and Aleksej Zelezniak for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended data fig. 1 study information..

Average a ) temperature data and b ) total precipitation per location over experiment with cadaver placement dates. Temperature data was collected from local weather stations reported to the National Centers for Environmental Information. Total monthly precipitation data was collected from Weather Underground. The vertical line represents the date of placement and line color denotes the season the body placement is considered to have been placed. c ) Upset plot illustrating the intersections between sample and omic types after extractions, processing and quality filtering that were used for further analyses. MetaG = metagenomics, Metab = metabolomics, 18S = 18S rRNA amplicon, and 16S = 16S rRNA amplicon.

Extended Data Fig. 2 Metabolome Comparison.

Principal coordinate analysis (PCoA) of a ) Jaccard and b ) Bray-Curtis distances of all unique metabolites and all metabolomic samples show cadaver skin and cadaver-associated soil are significantly different community profiles. n = 1503 biologically independent samples. Significance was determined by PERMANOVA (permutations = 999). Van Krevelen diagram showed a strong presence of lipid-like, protein-like, and lignin-like classes within c ) cadaver-associated soils and d ) cadaver skin. Metabolites that matched database chemical formulas or had a significantly predicted chemical formula were assigned a Van Krevelen organic compound classification by their hydrogen:carbon and oxygen:carbon molar ratios. Colors correspond to organic compound classification. Nominal oxidation state of carbon (NOSC) scores for cadaver-associated e ) soil and f ) cadaver skin metabolites with assigned chemical formulas show significant decrease of thermodynamic favorability at all geographical locations over decomposition time measured by accumulated degree days (ADD). Soil: ARF n = 251, STAFS n = 250, and FIRS n = 245 biologically independent samples. Skin: ARF n = 250, STAFS n = 249, and FIRS n = 249 biologically independent samples. Data are presented as mean values +/− 95% CI. Significance measured with linear mixed-effects models within each location and adding a random intercept for cadavers with two-tailed ANOVA and no multiple comparison adjustments. g ) Lipid-like metabolites show an increased abundance in cadaver-associated soils over decomposition measured by accumulated degree days (ADD) and significantly increase in temperate soils. h ) Protein-like metabolites are less abundant than lipid-like metabolites in cadaver-associated soils over decomposition measured by accumulated degree days (ADD) and significantly decrease in STAFS soil. ARF n = 251, STAFS n = 250, and FIRS n = 245 biologically independent samples. Data are presented as mean values +/− 95% CI. Significance measured with linear mixed-effects models within each location and adding a random intercept for cadavers with two-tailed ANOVA and no multiple comparison adjustments. Metabolite abundance normalized by center log ratio transformation.

Extended Data Fig. 3 Community Assembly.

Sankey diagram of the a ) 257 99% dereplicated, medium to high quality MAGs with Genome Taxonomy Database classifications and b ) the average MAG abundances (given as transcript per million, TPM) at each decomposition stage within each location. Proteobacteria and Bacteroidota representation increases with decomposition while Actinobacteria representation decreases at each location. This MAG set encompassed novel bacterial orders (n=3), families (n=9), genera (n=28), and species (n=158). Proteobacteria is the highest represented phylum. c ) Spearman correlation of the maximum ATP per C-mol for lipids, carbohydrates, and amino acids over ADD at each location represented by circle size. Metabolism efficiency is correlated with ADD in temperate climates. ARF n = 212, STAFS n = 198, and FIRS n = 158 biologically independent samples. Significance measured with linear mixed-effects models within each location and adding a random intercept for cadavers and denoted as p<0.05 (*), p<0.01 (**), and p<0.001 (***). ARF: Amino Acids p = <2e-16, STAFS: Amino Acids p = 1.18e-06, and Carbohydrate p = 4.22e-04. d ) The amino acid metabolism efficiency of the total community that can be attributed to O. alkaliphila and e ) the carbohydrate metabolism efficiency of the total community that can be attributed to C. intestinavium increase over decomposition at temperate locations as a product of the genome’s metabolism efficiency and relative abundance. Data plotted with loess regression as mean values +/− 95% CI. ARF n = 212, STAFS n = 198, and FIRS n = 158 biologically independent samples. f ) Pairwise comparisons to obtain beta nearest taxon index (βNTI) values focused on successional assembly trends by comparing initial non-decomposition soil to early decomposition soil then early to active, etc. (PL = placement, EA = early, AC = active, AD = advanced) in the 16S rRNA amplicon dataset. Relative abundance of assembly forces reveals that heterogeneous selection (βNTI > +2) pressure increases and homogenous selection (βNTI < -2) decreases over decomposition. Stochastic forces are a constant driver of community assembly (+2 > βNTI > -2). g ) Predicted metabolic competition from metagenome-assembled genomes are site-specific and significantly altered over decomposition. STAFS: early-active p = 3.42e-11, early-advanced p = 1.23e-11, active-advanced p = 7.85-41, FIRS: early-active p = 0.042. h ) Predicted metabolic cooperation and competition from metagenome-assembled genomes randomly subsampled into 20-member communities within each site and decomposition serves as a null model comparison signifying the importance of MAG co-occurrence. ARF n = 201, STAFS n = 188, and FIRS n = 151 biologically independent samples. The lower and upper hinges of the boxplot correspond to the first and third quartiles (the 25th and 75th percentiles). The upper whisker extends from the hinge to the largest value no further than 1.5 * IQR from the hinge, and the lower whisker extends from the hinge to the smallest value at most 1.5 * IQR of the hinge. The center of the boxplot is represented by the median. Significance measured with Dunn Kruskal-Wallis H-test with multiple comparison p-values adjusted with the Benjamini-Hochberg method as denoted by p<0.05 (*), p<0.01 (**), and p<0.001 (***).

Extended Data Fig. 4 Multi-omic Integration.

a ) ASV richness comparison between decomposition soil and control soil over the decomposition time frame reveals that bacterial richness decreases significantly at temperate locations. ARF n = 414, STAFS n = 316, and FIRS n = 310 biologically independent samples. Significance measured with linear mixed-effects models within each location and adding a random intercept for cadavers with two-tailed ANOVA and no multiple comparison adjustments. ARF and STAFS richness p = <2e-16. Denoted as p<0.05 (*), p<0.01 (**), and p<0.001 (***). b ) Multi-omic joint-RPCA shows that microbial community ecology is impacted by season and geographical location. Multi-omic Joint-RPCA incorporates soil 16S rRNA, 18S rRNA, metabolomic, and metagenome-assembled genome data. All data types used the same n = 374 biologically independent samples. Multi-omics joint-RPCA principal component scores show that c ) facility variation is primarily explained by principal component 3 (PC3) and PC4, d ) decomposition stage is primarily explained by PC2, e ) season is primarily explained by PC1, and f ) climate is primarily explained by PC3 and PC4 as described by the least overlap of PC values between groups. g ) PC2 from the multi-omics joint-RPCA scores for each geographical location over decomposition stages shows the temperate climate locations are the most dynamic in their microbial ecology. Multi-omic Joint-RPCA incorporates soil 16S rRNA, 18S rRNA, metabolomic, and metagenome-assembled genome data. All data types used the same n = 374 biologically independent samples. Data in panel g are presented as mean values +/− 95% CI.

Extended Data Fig. 5 Universal Initial Non-Decomposition And Early Decomposition Soil Network.

Top 20% of correlations between selected nodes for the universal initial non-decomposition and early decomposition soil log-ratio signal in Joint-RPCA PC2 visualized in co-occurrences network. All data types used the same n = 374 biologically independent samples.

Extended Data Fig. 6 Decomposer ASVs Placed in Current Databases.

Phylogenetic tree representing ASVs associated with the key decomposer nodes from the network placed along within the top 50 most abundant ASVs taken from AGP gut, AGP skin, EMP soil, and EMP host-associated datasets demonstrates key decomposers are largely phylogenetically unique. Innermost ring represents decomposer placement while outer rings represent AGP and EMP ASVs, for which bar height represents ASV rank prevalence within each environment. AGP and EMP ASVs were ranked according to the number of samples they were found in each environment. A lack of bars represents that the ASV was not present within the dataset. Decomposer ASVs are numbered clockwise with full taxonomy available in Supplementary Table 27 .

Extended Data Fig. 7 Important Features for 16S rRNA Random Forest Models.

The 20 most important SILVA level-7 taxa as determined in the 16S rRNA random forest regression models for predicting postmortem interval shows that many of the same taxa appear important for model prediction within all sample types, but some differences do emerge.

Extended Data Fig. 8 Longitudinal Abundances of Important Features.

The 6 most important SILVA level-7 taxa as determined in the 16S rRNA data from the a ) skin of the face, b ) skin of the hip, c ) soil associated with the hip, and d ) soil associated with the face for random forest regression models for predicting postmortem interval. Data plotted by the taxa and the normalized abundance change over ADD at each geographic location. Data plotted with loess regression and 16S rRNA soil face, soil hip, skin face, and skin hip datasets contain n = 600, 616, 588, and 500 biologically independent samples, respectively. Data are presented as mean values +/− 95% CI.

Extended Data Fig. 9 16S rRNA Random Forest Model Validation.

a ) Total body scores (TBS) used to train a random forest model for prediction of PMI (ADD) shows that TBS scores can predict PMI relatively accurately based on a low MAE but have higher variability in their predictions as represented by a higher residual value than microbiome-based models. Models built from 16S rRNA data using SILVA level-7 taxa from the skin and soil associated with the hip were validated with b ) an independent test set of samples that were collected from cadavers at locations and climates not represented in our model and c ) the same data where samples were given randomly assigned ADDs within the range of true ADDs to serve as a null model. Significance measured with linear mixed-effects models within each location and adding a random intercept for cadavers with two-tailed ANOVA and no multiple comparison adjustments. Data are presented as mean values +/− 95% CI.

Extended Data Fig. 10 Diversity Comparison between 16S rRNA and Metagenomic Data.

PCoA ordination plots of Bray-Curtis dissimilarity matrices calculated from paired rarefied 16S rRNA feature abundances (left) and TPM-normalized MAG abundances (right) from the soil adjacent to the hip. Procrustes/PROTEST and mantel tests were performed between the PCoA ordinances and distance matrices, respectively. n = 480 biologically independent samples, respectively.

Supplementary information

Supplementary information.

Legends for Supplementary Tables 1–9, 14–16 and 25–39. Supplementary Tables 10–13 and 17–24, and Text.

Reporting Summary

Supplementary tables.

Supplementary Table 1. Sample metadata. Table includes data taken during intake and over the course of the study. Table 2. ANCOM-BC differential abundance analysis results of cadaver skin metabolite log-ratio change over decomposition stages. Initial day 0 samples were used as the reference level and the intercept. Results include log-ratio changes of day 0 metabolites to early, active and advanced decomposition stages, P values, Holm–Bonferroni-corrected P values ( Q values), standard errors and W values. Table 3. ANCOM-BC differential abundance analysis results of cadaver-associated soil metabolite log-ratio change over decomposition stages. Initial day 0 samples were used as the reference level and the intercept. Results include log-ratio changes of day 0 metabolites to early, active and advanced decomposition stages, P values, Holm–Bonferroni-corrected P values ( Q values), standard errors and W values. Table 4. List of samples used to generate shotgun metagenomic data. Table 5. Assembly statistics and GTDB taxonomic classification of genomic bins (metagenome-assembled genomes; MAGs) co-assembled from the metagenomic samples. Table includes completeness and contamination of each MAG. Table 6. TPM-normalized count abundance of MAGs within metagenomic samples. Table 7. Linear mixed-effects model statistics for testing response variable change of ATP per C-mol amino acids calculated from metagenomic data over ADD at each facility and a random intercept for each individual body to account for repeated measures to test whether the metabolism efficacy shifts within each facility. Formula: ‘ATPm ≈ ADD + (1|body ID)’. Table 8. Linear mixed-effects model statistics for testing response variable change of ATP per C-mol carbohydrates calculated from metagenomic data over ADD at each facility and a random intercept for each individual body to account for repeated measures to test whether the metabolism efficacy shifts within each facility. Formula: ‘ATPm ≈ ADD + (1|body ITable 9. Linear mixed-effects model statistics for testing response variable change of ATP per C-mol lipids calculated from metagenomic data over ADD at each facility and a random intercept for each individual body to account for repeated measures to test whether the metabolism efficacy shifts within each facility. Formula: ‘ATPm ≈ ADD + (1|body ID)’. Table 14. Number of predicted exchanges for cross-fed compounds at each facility during late decomposition. Late decomposition was defined as the advanced decomposition stage at STAFS and ARF and the active decomposition stage at FIRS. Table 15. Linear mixed-effects model statistics for testing response variable change of Generalized UniFrac PC1 distances calculated from 16S rRNA gene data over ADD at each facility with sampling site (that is, soil adjacent to hip vs soil control) as an independent variable (fixed effect) and a random intercept for each individual body to account for repeated measures. The models measure the sampling site and ADD variables individually and the interaction between the variables. The interaction between the variables was used to test whether the sampling sites respond differently to decomposition. Formula: ‘diversity metric ≈ ADD × sampling site + (1|body ID)’. Table 16. Linear mixed-effects model statistics for testing response variable change of ASV richness calculated from 16S rRNA gene data over ADD at each facility with sampling site (that is, soil adjacent to hip vs soil control) as an independent variable (fixed effect) and a random intercept for each individual body to account for repeated measures. The models measure the sampling site and ADD variables individually and the interaction between the variables. The interaction between the variables was used to test whether the sampling sites respond differently to decomposition. Formula: ‘diversity metric ≈ ADD × sampling site + (1|body ID)’. Table 25. Joint-RPCA PC2 correlations calculated between network feature nodes that correspond with late (that is, active and advanced) decomposition soil. Table 26. Joint-RPCA PC2 correlations calculated between network feature nodes in initial, non-decomposition and early decomposition soil. Table 27. 16S rRNA gene ASVs assigned to the same taxonomy as decomposer network taxa. Table includes the phylogenetic tree labels in Fig. 4e, 150-bp-long ASVs and trimmed 100-bp-long ASVs used to explore ASV presence in other studies. Table 28. Presence of universal decomposers in possible human and terrestrial source environments in a few other studies. Table shows the average relative abundance of each decomposer ASV across each sample type. Average relative abundances were then summed for each decomposer genus. Table 29. Cross-feeding statistics for MAGs predicted as cross-feeders during late decomposition. Table includes GTDB taxonomic classification, number of reactions each MAG was considered the compound receiver and/or donor, and the percent responsible for all donations and acceptances during late decomposition. Late decomposition was defined as the advanced decomposition stage at STAFS and ARF and the active decomposition stage at FIRS. Table 30. Cross-feeding exchanges for Oblitimonas alkaliphila during late decomposition. Oblitimonas alkaliphila was not a predicted cross-feeder at FIRS during this timeframe. Table includes MAG ID and taxonomic classification of genomes involved in exchange, compounds exchanged and computed interaction metrics. Table 31. Cross-feeding exchanges for l -arginine or ornithine during late decomposition. Table includes MAG ID and taxonomic classification of genomes involved in exchange, compounds exchanged and computed interaction metrics. Table 32. Model validation results from predicting an independent test set of samples using the 16S rRNA gene at the SILVA database level-7 taxonomic rank random forest regression models for the skin of the hip and soil adjacent to the hip. Errors are represented by MAE in ADD. Table 33. Presence of universal decomposers in a few other studies focused on mammalian decomposition environments. A search for the 35 universal PMI decomposer ASVs was conducted within each dataset. The relative abundance of each decomposer ASV was first averaged across all samples within a specific metadata category. The average relative abundances were then summed across each decomposer genus. Prevalence tables were constructed by summing the number of samples across a specific metadata category in which each universal decomposer ASV was present. Table 34. The average ADD per calendar day calculated for each cadaver at each facility. The average ADD per calendar day was calculated by dividing the final maximum ADD values by the total number of days (that is, 21). The average ADD per day was calculated for each cadaver, season and facility, each climate type and as a study-wide average. Table 35. The average ADD per calendar day calculated for each cadaver at each facility for the independent test set. The average ADD per calendar day was calculated by dividing the final maximum ADD values by the total number of sampling days. The average ADD per day was calculated for each cadaver, facility and as a study-wide average. Table 36. Metabolite identification information for metabolites that had a predicted chemical formula or matched to a compound in the database library. When available, chemical formulas in the database library took precedence over predicted chemical formulas for calculating NOSC and major biochemical classes based on the molar H:C and O:C ratios. Table 37. Soil metabolite feature table normalized with sum normalization then scaled with pareto scaling. Table includes chemical formulas and major biochemical classes based on the molar H:C and O:C ratios. Table 38. Skin metabolite feature table normalized with sum normalization then scaled with pareto scaling. Table includes chemical formulas and major biochemical classes based on the molar H:C and O:C ratios. Table 39. Sample metadata for the machine learning independent test set. Table includes data taken during intake and over the course of the study.

Source Data for Figs. 1–6, Extended Data Figs. 1–6 and Extended Data Fig. 9

SD for Fig. 1. Sample type counts and sample metadata. SD for Fig. 2. ATP per C-mol for each substrate by sample and pairwise beta-NTI calculations. SD for Fig. 3. SMETANA MIP and MRO score calculations, predicted cross-fed metabolites, Faith’s PD calculations and joint-RPCA distance matrix/ordination. SD for Fig. 4. Joint-RPCA distance matrix/ordination and multi-omic log ratios. SD for Fig. 5. Late decomposition multi-omic correlations. SD for Fig. 6. Random forest predictions, 16S rRNA model important features and 16S rRNA SILVA-L7 feature table. SD for ED Fig. 1. Site weather data. SD for ED Fig. 2. Metabolite feature table, chemical formulas and Van Krevelen metabolite classifications. SD for ED Fig. 3. MAG taxonomy and feature table, amino acid and carbohydrate ATP per C-mol per MAG and sample. SD for ED Fig. 4. 16S rRNA calculated richness. SD for ED Fig. 5. Initial/early decomposition multi-omic correlations. SD for ED Fig. 6. Top rank taxa for phylogenetic tree comparing ASVs found during decomposition and in the EMP and AGP datasets. SD for ED Fig. 9. 16S rRNA random forest validation predictions

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

Burcham, Z.M., Belk, A.D., McGivern, B.B. et al. A conserved interdomain microbial network underpins cadaver decomposition despite environmental variables. Nat Microbiol (2024). https://doi.org/10.1038/s41564-023-01580-y

Download citation

Received : 28 June 2023

Accepted : 08 December 2023

Published : 12 February 2024

DOI : https://doi.org/10.1038/s41564-023-01580-y

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

This article is cited by

Decomposer communities are universal in death.

  • Michael S. Strickland
  • Laurel Lynch

Nature Microbiology (2024)

Quick links

  • Explore articles by subject
  • Guide to authors
  • Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

how to learn to write journal

IMAGES

  1. Journal Writing Guide: How to Start a Journal and Write Entries

    how to learn to write journal

  2. How to Write a Journal

    how to learn to write journal

  3. Pin on Writing

    how to learn to write journal

  4. 5 Ways to Write a Journal Entry

    how to learn to write journal

  5. 10 Easy Steps: How to Write a Journal Example in 2023

    how to learn to write journal

  6. How to Write a Diary (with Sample Entries)

    how to learn to write journal

VIDEO

  1. Things to write in journal or diary #daily #aesthetic

  2. Purpose of Journal

  3. Journal writing video 1

  4. How to write journal and articles for my English class

  5. What to write in your journal ✨ #journaling #artjournal #journalideas

  6. How To Write A Journal|What To Write When To Write A Journal|Journal Writting Tips For beginers

COMMENTS

  1. How to Journal

    Journal Writing is the practice of taking time for yourself to write and reflect on your thoughts, feelings and life experiences. There are many suggestions for how to journal and what to write about. However, the beauty of journal writing is you can do it in your own way.

  2. How to Start and Keep a Journal: Complete Journal Writing Guide

    How to Start and Keep a Journal: Complete Journal Writing Guide Written by MasterClass Last updated: Sep 13, 2021 • 5 min read On some level, a motive for all writing is self-expression. Journaling is an effective way to keep in contact with your own thoughts, improve your writing ability, and develop disciplined writing habits. Articles Videos

  3. How to Write a Journal: 6 Tips to Get Started

    So how to write a journal? What to write in a journal? Let's look at some simple ways to start capturing ideas. There are a number of ways to capture ideas, from keeping a gratitude journal, to a reading journal, to a project journal.

  4. How to Start Journaling: 7 Tips & Techniques for Beginners

    Take quiz What is journaling? Journaling involves writing down your thoughts and feelings as you navigate everyday life. Journaling can help you understand and work through your emotions, especially when you're feeling anxious or sad. It can also help you grow, become more self-aware, and gain meaningful insights.

  5. How To Start A Journal: A Beginner's Guide To Journaling

    There are so many different ways you can journal. Here are some journaling styles to try out: 1. Gratitude Journaling Gratitude Journaling works like this: Every morning and evening, you write down things you are grateful for. I usually write down three things but feel free to write down as many as you can. It's the ultimate happiness boost!

  6. How to Start a Journal (with Sample Entries)

    1 Find a notebook to write in. The book can be simple or ornate. If you're happy with a simple journal, then just buy a basic college-ruled notebook. If you want something more serious, look for a nice leather-bound journal - perhaps even one with a lock and key! Choose between a lined or an unlined notebook.

  7. 32 Journaling Tips For Beginners

    1. Tackling The First Page 2. Keep a Prompt List 3. Use a Guided Journal 4. Find What Works for You 5. Embrace Mess 6. Don't Edit as You Go 7. Carry Your Journal at All Times 8. Write to Yourself 9. Write to Someone Else 10. Write About What You Want 11. Write In Different Places 12. Turn Off Distractions 13. Set a Timer 14. Do It On Paper 15.

  8. Learn to Journal: Tips and Ideas

    Journaling is the act of writing down your thoughts, feelings, experiences, and memories. While some people might use their phone's note-taking app as a place to journal, most would consider true journaling to involve using a pen and paper.

  9. How To Write A Journal: In 7 Simple Steps

    Step 1: Pick a Time for Journaling Step 2: Select a Topic to Write About Step 3: Journal for a Pre-determined Period Step 4: Don't Stop To Edit Step 5: Explore Your Thinking Step 6: Stop and Tidy Up Step 7: Review Your Journal Entries Regularly Keeping Multiple Journals How To Find Time for Journal Writing Using Journal Writing Prompts

  10. Journal Writing Guide: How to Start a Journal and Write Entries

    Home Journals How To Start and Write a Journal We keep a lot of things in our heads, but we put less down on paper. All those thoughts and ideas bouncing around can sometimes feel overwhelming. You have to-do lists, hopes, dreams, secrets, failures, love, loss, ups and downs. Ideas come and go, feelings pass. How do you remember all of them?

  11. Writing in a Journal: A Short Course on Journal Writing for 2023

    How to Get Started with Journal Writing It's Easy to W.R.I.T.E. Just try these five easy steps. You'll be writing in no time! W - What do you want to write about? What's going on? How do you feel? What are you thinking about? What do you want? Name it. R - Review or reflect on it. Close your eyes. Take three deep breaths. Focus.

  12. The Benefits of and Tips for Journaling

    The benefits of journaling. Science supports the anecdotal evidence of journaling's positive effect on mental health. According to Elizabeth Gilbert, the head of research at PsychologyCompass, "decades of research" back up the benefits of journaling when it comes to reducing anxiety, easing depression, working through trauma, and setting goals.

  13. Academic Writing, and How to Learn How to Write

    Explaining how to organize your work in order to write more, Paul J. Silva also does not offer advice on how to write well. 6. There are quite a few books that do not tell stories about writers and writing, but that show what good writing is and how to write well. Yarris and colleagues provided a perfect example: Helen Sword's Stylish Academic ...

  14. How to Write a Journal: 13 Steps (with Pictures)

    1 Find something to contain your journal entries. Traditionally, people who kept journals used literal, physical journals - small paper notebooks. You may want to use a cheap spiral or composition notebook or opt for a nicer hardcover journal. Today, however, a variety of additional digital options are also available.

  15. How to Write Better: 5 Benefits of Journaling

    Writing How to Write Better: 5 Benefits of Journaling Written by MasterClass Last updated: Aug 30, 2021 • 3 min read If you've ever struggled to remember a great idea you had in the past or wished you had a more concrete recollection of important life events, you might want to consider keeping a journal.

  16. 9 JOURNALING TIPS for beginners

    have you always wanted to start journaling but you weren't sure where to even begin? well get your notebook and pen and a cup of tea, get comfy, and let's st...

  17. How to Write Journal Entries

    Lists. Lists are a great way to ease into a journal writing session. You can make lists of anything: favorites, likes, dislikes, to-dos, not to-dos—the list, of course, goes on. Your entry may be the list or lists themselves or spark a memory or story idea you'd like to explore in a new entry. Story ideas.

  18. How to Journal: Writing Tips, Journal Topics, and More!

    Writing in a journal is a great way to destress, but starting one can be daunting. In this video, we'll show you some of our favorite tips on how to journal....

  19. How to Journal: 5 Pro Tips and 40 Prompts to Get You Started

    What's the best way to journal? If you're new, try out a few different approaches before you decide which one you resonate with most. Remember, journaling is supposed to benefit you. Don't stick with a method because others you know enjoy that approach or because you feel like you "should."

  20. Journaling for Professional Development

    Journaling can help you to: Identify mistakes that you have made, and reflect on how to avoid them in the future. Review your learning, cementing new concepts in your mind and keeping information fresh. Develop your critical thinking and problem-solving skills. Become more self-aware and emotionally intelligent.

  21. Language Journal Ideas: What to Write, When to Write and How ...

    1. Record milestones on your learning journey 2. Play with new words you've learned 3. Look for activities that can become journal entries 4. Compare grammar rules to your native language 5. Write about your thoughts and feelings 6. Write about cultural customs Tips for Effective Language Journaling Include the date and a title Write quickly

  22. Language Learning Journal: How to Start Yours (+ What to Write)

    Journaling is a creative and free-flowing way to keep track of your progress as you learn a language. It can help you plan what you want to learn, recap what you've studied, and note what confuses you. You can include many valuable things in your journal, from vocabulary lists to key insights about your learning style.

  23. How to Write a Learning Journal

    A learning journal is an excellent tool for any serious student. By creating a record of what you have learned, you are better able to make connections with previous knowledge, to understand the obstacles that go into acquiring that knowledge and to chart your own intellectual development and personal growth.

  24. How a gratitude journal can make life more meaningful

    Staying consistent in your practice of writing in a gratitude journal can help you gain further benefits and become comfortable with this practice. Getty How to keep a gratitude journal: Tips and techniques. Keeping a gratitude journal may benefit your overall well-being by introducing elements of positive psychology into your daily routine.

  25. Why learn APA Style if you already know MLA style?

    To learn how JARS can be relevant to you, check out this blog post about APA Style JARS for high school students. Bias-free and inclusive language APA provides detailed, science-backed guidelines on how to describe people with dignity and respect in the form of the bias-free language guidelines and the Inclusive Language Guide (2nd ed.) .

  26. How journaling can help you manage your mental health

    The most common type of journaling involves writing down not just a list of one's daily activities, but also a reflection on the thoughts and emotions that come up during the day.

  27. A conserved interdomain microbial network underpins cadaver ...

    Machine learning reveals a predictable microbial decomposer ecology The assembly of a universal microbial decomposer network suggests the potential to build a robust forensics tool.